Gene Page: CDC37
Summary ?
GeneID | 11140 |
Symbol | CDC37 |
Synonyms | P50CDC37 |
Description | cell division cycle 37 |
Reference | MIM:605065|HGNC:HGNC:1735|Ensembl:ENSG00000105401|HPRD:05456|Vega:OTTHUMG00000180578 |
Gene type | protein-coding |
Map location | 19p13.2 |
Pascal p-value | 0.492 |
Sherlock p-value | 0.993 |
Fetal beta | -0.363 |
DMG | 2 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Montano_2016 | Genome-wide DNA methylation analysis | This dataset includes 172 replicated associations between CpGs with schizophrenia. | 2 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0217 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg21302812 | 19 | 10506915 | CDC37 | 1.59E-4 | 0.004 | 0.142 | DMG:Montano_2016 |
cg21302812 | 19 | 10506915 | CDC37 | 2.676E-4 | 0.286 | 0.038 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10409262 | chr19 | 58154954 | CDC37 | 11140 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/CDC37_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0051082 | unfolded protein binding | TAS | 8666233 | |
GO:0051879 | Hsp90 protein binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000079 | regulation of cyclin-dependent protein kinase activity | TAS | 8666233 | |
GO:0006605 | protein targeting | TAS | 8666233 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | IEA | - | |
GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AR | AIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFM | androgen receptor | - | HPRD,BioGRID | 11085988 |
CDK4 | CMM3 | MGC14458 | PSK-J3 | cyclin-dependent kinase 4 | - | HPRD,BioGRID | 8666233 |8703009 |
CHUK | IKBKA | IKK-alpha | IKK1 | IKKA | NFKBIKA | TCF16 | conserved helix-loop-helix ubiquitous kinase | - | HPRD,BioGRID | 11864612 |
CHUK | IKBKA | IKK-alpha | IKK1 | IKKA | NFKBIKA | TCF16 | conserved helix-loop-helix ubiquitous kinase | IKK-alpha interacts with Cdc37. This interaction was modeled on a demonstrated interaction between IKK-alpha from an unspecified species and human Cdc37. | BIND | 11864612 |
ERBB2 | CD340 | HER-2 | HER-2/neu | HER2 | NEU | NGL | TKR1 | v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) | An unspecified isoform of ERBB2 interacts with P50CDC37. This interaction was modelled on a demonstrated interaction between human ERBB2 and monkey P50CDC37. | BIND | 15643424 |
HSP90AA1 | FLJ31884 | HSP86 | HSP89A | HSP90A | HSP90N | HSPC1 | HSPCA | HSPCAL1 | HSPCAL4 | HSPN | Hsp89 | Hsp90 | LAP2 | heat shock protein 90kDa alpha (cytosolic), class A member 1 | Co-crystal Structure in vitro | BioGRID | 9685350 |14718169 |
HSP90AA1 | FLJ31884 | HSP86 | HSP89A | HSP90A | HSP90N | HSPC1 | HSPCA | HSPCAL1 | HSPCAL4 | HSPN | Hsp89 | Hsp90 | LAP2 | heat shock protein 90kDa alpha (cytosolic), class A member 1 | - | HPRD | 9685350|14718169 |
IKBKB | FLJ40509 | IKK-beta | IKK2 | IKKB | MGC131801 | NFKBIKB | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta | Co-purification Reconstituted Complex | BioGRID | 11864612 |
IKBKB | FLJ40509 | IKK-beta | IKK2 | IKKB | MGC131801 | NFKBIKB | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta | IKK-beta interacts with Cdc37. This interaction was modeled on a demonstrated interaction between IKK-beta from an unspecified species and human Cdc37. | BIND | 11864612 |
IKBKE | IKK-i | IKKE | IKKI | KIAA0151 | MGC125294 | MGC125295 | MGC125297 | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon | Affinity Capture-MS | BioGRID | 14743216 |
IKBKG | AMCBX1 | FIP-3 | FIP3 | Fip3p | IKK-gamma | IP | IP1 | IP2 | IPD2 | NEMO | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma | - | HPRD,BioGRID | 11864612 |
MAP3K1 | MAPKKK1 | MEKK | MEKK1 | mitogen-activated protein kinase kinase kinase 1 | Affinity Capture-MS | BioGRID | 14743216 |
MAP3K3 | MAPKKK3 | MEKK3 | mitogen-activated protein kinase kinase kinase 3 | Affinity Capture-MS | BioGRID | 14743216 |
MAP3K7 | TAK1 | TGF1a | mitogen-activated protein kinase kinase kinase 7 | - | HPRD | 14743216 |
NEK6 | SID6-1512 | NIMA (never in mitosis gene a)-related kinase 6 | Affinity Capture-MS | BioGRID | 17353931 |
SGK1 | SGK | serum/glucocorticoid regulated kinase 1 | Affinity Capture-MS | BioGRID | 17353931 |
SMYD2 | HSKM-B | KMT3C | MGC119305 | ZMYND14 | SET and MYND domain containing 2 | Affinity Capture-MS | BioGRID | 17353931 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | Reconstituted Complex | BioGRID | 11085988 |
STIP1 | HOP | IEF-SSP-3521 | P60 | STI1 | STI1L | stress-induced-phosphoprotein 1 | - | HPRD | 12437126 |
STK11 | LKB1 | PJS | serine/threonine kinase 11 | - | HPRD,BioGRID | 12489981 |
TBK1 | FLJ11330 | NAK | T2K | TANK-binding kinase 1 | Affinity Capture-MS | BioGRID | 14743216 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID ILK PATHWAY | 45 | 32 | All SZGR 2.0 genes in this pathway |
PID LKB1 PATHWAY | 47 | 37 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ERBB2 | 101 | 78 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY CONSTITUTIVELY ACTIVE EGFR | 18 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY EGFR IN CANCER | 109 | 80 | All SZGR 2.0 genes in this pathway |
HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION DN | 234 | 147 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION DN | 84 | 54 | All SZGR 2.0 genes in this pathway |
SCHEIDEREIT IKK INTERACTING PROTEINS | 58 | 45 | All SZGR 2.0 genes in this pathway |
INGRAM SHH TARGETS DN | 64 | 41 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
GARCIA TARGETS OF FLI1 AND DAX1 DN | 176 | 104 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
PEART HDAC PROLIFERATION CLUSTER UP | 57 | 35 | All SZGR 2.0 genes in this pathway |
DORSAM HOXA9 TARGETS DN | 32 | 22 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS UP | 126 | 84 | All SZGR 2.0 genes in this pathway |
ABRAHAM ALPC VS MULTIPLE MYELOMA DN | 19 | 14 | All SZGR 2.0 genes in this pathway |
TAKAO RESPONSE TO UVB RADIATION UP | 86 | 55 | All SZGR 2.0 genes in this pathway |
MARTINEZ RESPONSE TO TRABECTEDIN UP | 71 | 49 | All SZGR 2.0 genes in this pathway |
MURAKAMI UV RESPONSE 6HR UP | 37 | 31 | All SZGR 2.0 genes in this pathway |
GERHOLD ADIPOGENESIS DN | 64 | 44 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C0 | 107 | 72 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS DN | 141 | 92 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER T7 | 98 | 63 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS | 212 | 121 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL DN | 216 | 143 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
BILANGES SERUM SENSITIVE GENES | 90 | 54 | All SZGR 2.0 genes in this pathway |
HOLLEMAN DAUNORUBICIN B ALL UP | 10 | 9 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-182 | 234 | 240 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-96 | 234 | 240 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.