Gene Page: FMNL2
Summary ?
GeneID | 114793 |
Symbol | FMNL2 |
Synonyms | FHOD2 |
Description | formin like 2 |
Reference | MIM:616285|HGNC:HGNC:18267|Ensembl:ENSG00000157827|HPRD:13545|Vega:OTTHUMG00000154035 |
Gene type | protein-coding |
Map location | 2q23.3 |
Pascal p-value | 0.002 |
Sherlock p-value | 0.464 |
Fetal beta | 0.259 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 | |
Expression | Meta-analysis of gene expression | P value: 1.73 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg25751974 | 2 | 153474786 | FMNL2 | 2.512E-4 | -0.551 | 0.037 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6448932 | chr4 | 12595798 | FMNL2 | 114793 | 0.12 | trans | ||
rs6480996 | chr10 | 54896815 | FMNL2 | 114793 | 0.18 | trans | ||
rs7907658 | chr10 | 92792387 | FMNL2 | 114793 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003779 | actin binding | IEA | - | |
GO:0003700 | transcription factor activity | IEA | - | |
GO:0017048 | Rho GTPase binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0016043 | cellular component organization | IEA | - | |
GO:0030036 | actin cytoskeleton organization | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
DAIRKEE TERT TARGETS DN | 124 | 79 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS UP | 292 | 168 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS PROLIFERATION UP | 178 | 108 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
IKEDA MIR133 TARGETS UP | 43 | 27 | All SZGR 2.0 genes in this pathway |
KATSANOU ELAVL1 TARGETS DN | 148 | 88 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP | 289 | 184 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 788 | 794 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-137 | 1830 | 1836 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG | ||||
miR-142-3p | 1913 | 1919 | m8 | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
miR-181 | 1451 | 1457 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-203.1 | 1530 | 1537 | 1A,m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-219 | 883 | 889 | m8 | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
miR-23 | 1260 | 1266 | 1A | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-34/449 | 1568 | 1574 | 1A | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-381 | 1215 | 1221 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-410 | 1302 | 1308 | m8 | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-493-5p | 1320 | 1326 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
miR-496 | 274 | 280 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-543 | 1452 | 1459 | 1A,m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.