SZGR2

Summary ?

GeneID	155
Symbol	ADRB3
Synonyms	BETA3AR
Description	adrenoceptor beta 3
Reference	MIM:109691\|HGNC:HGNC:288\|Ensembl:ENSG00000188778\|HPRD:00188\|Vega:OTTHUMG00000164028
Gene type	protein-coding
Map location	8p11.23
Pascal p-value	0.756
Fetal beta	0.059
Support	GPCR SIGNALLING

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PSMD13	0.88	0.91
DUT	0.86	0.85
TMEM106C	0.86	0.90
SAMM50	0.85	0.84
POLR2G	0.85	0.85
HTRA2	0.85	0.88
COPS6	0.84	0.85
VPS25	0.84	0.87
MRPL11	0.84	0.85
C11orf79	0.84	0.86

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.8	-0.66	-0.69
AF347015.2	-0.66	-0.72
AF347015.26	-0.66	-0.74
AF347015.15	-0.66	-0.71
AF347015.27	-0.65	-0.69
MT-CYB	-0.65	-0.69
MT-CO2	-0.64	-0.65
AF347015.33	-0.63	-0.69
AF347015.31	-0.60	-0.64
MT-ATP8	-0.60	-0.70

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0051380	norepinephrine binding	IDA	Neurotransmitter (GO term level: 4)	15123695
GO:0004872	receptor activity	IEA		-
GO:0015052	beta3-adrenergic receptor activity	IMP		9892244
GO:0042803	protein homodimerization activity	IDA		15123695
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0002032	desensitization of G-protein coupled receptor protein signaling pathway by arrestin	IDA		15123695
GO:0007190	activation of adenylate cyclase activity	IDA		15123695
GO:0007188	G-protein signaling, coupled to cAMP nucleotide second messenger	TAS		1718744
GO:0006112	energy reserve metabolic process	TAS		1718744
GO:0006091	generation of precursor metabolites and energy	TAS		2570461
GO:0005975	carbohydrate metabolic process	TAS		2570461
GO:0007165	signal transduction	IEA		-
GO:0006898	receptor-mediated endocytosis	IDA		15123695
GO:0043410	positive regulation of MAPKKK cascade	IDA		15123695
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0043235	receptor complex	IDA	Neurotransmitter (GO term level: 4)	15123695
GO:0005886	plasma membrane	TAS		1718744
GO:0005887	integral to plasma membrane	TAS		1718744

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION	272	195	All SZGR 2.0 genes in this pathway
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS	305	177	All SZGR 2.0 genes in this pathway
REACTOME AMINE LIGAND BINDING RECEPTORS	38	33	All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING	805	368	All SZGR 2.0 genes in this pathway
REACTOME G ALPHA S SIGNALLING EVENTS	121	82	All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING	408	246	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST PRENEOPLASTIC DN	55	33	All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST TUMORS 324 DN	149	93	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK DN	196	131	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 8P12 P11 AMPLICON	57	32	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
NADLER OBESITY DN	48	34	All SZGR 2.0 genes in this pathway
NADLER HYPERGLYCEMIA AT OBESITY	58	35	All SZGR 2.0 genes in this pathway
STAEGE EWING FAMILY TUMOR	33	22	All SZGR 2.0 genes in this pathway
RUAN RESPONSE TO TNF TROGLITAZONE DN	42	24	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP	244	165	All SZGR 2.0 genes in this pathway
RUAN RESPONSE TO TNF DN	84	50	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
LI ADIPOGENESIS BY ACTIVATED PPARG	17	12	All SZGR 2.0 genes in this pathway
SARTIPY NORMAL AT INSULIN RESISTANCE DN	21	11	All SZGR 2.0 genes in this pathway
GERHOLD ADIPOGENESIS UP	49	40	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
ICHIBA GRAFT VERSUS HOST DISEASE 35D DN	49	34	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
FONTAINE PAPILLARY THYROID CARCINOMA UP	66	38	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3	210	148	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP	857	456	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
VERNOCHET ADIPOGENESIS	19	11	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	521	528	1A,m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ADRB3