SZGR2

Summary ?

GeneID	1915
Symbol	EEF1A1
Synonyms	CCS-3\|CCS3\|EE1A1\|EEF-1\|EEF1A\|EF-Tu\|EF1A\|GRAF-1EF\|HNGC:16303\|LENG7\|PTI1\|eEF1A-1
Description	eukaryotic translation elongation factor 1 alpha 1
Reference	MIM:130590\|HGNC:HGNC:3189\|Ensembl:ENSG00000156508\|HPRD:00559\|
Gene type	protein-coding
Map location	6q14.1
Pascal p-value	0.85
Sherlock p-value	0.003
Fetal beta	0.715
Support	RNA AND PROTEIN SYNTHESIS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.2361

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003746	translation elongation factor activity	IEA		-
GO:0003746	translation elongation factor activity	NAS		3570288
GO:0003924	GTPase activity	IEA		-
GO:0003924	GTPase activity	NAS		3570288
GO:0005515	protein binding	IPI		15231747 \|17373842
GO:0005525	GTP binding	IEA		-
GO:0005525	GTP binding	TAS		3512269
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006414	translational elongation	EXP		15189156
GO:0006414	translational elongation	IEA		-
GO:0006414	translational elongation	NAS		3570288
GO:0006414	translational elongation	TAS		8812466
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005829	cytosol	EXP		10368288
GO:0005853	eukaryotic translation elongation factor 1 complex	TAS		2564392
GO:0005737	cytoplasm	IEA		-
GO:0005737	cytoplasm	NAS		-
GO:0005737	cytoplasm	TAS		3512269

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ANKRD24	KIAA1981	ankyrin repeat domain 24	Two-hybrid	BioGRID	16169070
ARIH2	ARI2 \| FLJ10938 \| FLJ33921 \| TRIAD1	ariadne homolog 2 (Drosophila)	Two-hybrid	BioGRID	16169070
AXIN1	AXIN \| MGC52315	axin 1	Two-hybrid	BioGRID	16169070
BRMS1	DKFZp564A063	breast cancer metastasis suppressor 1	Two-hybrid	BioGRID	16169070
BTBD2	-	BTB (POZ) domain containing 2	Two-hybrid	BioGRID	16169070
C11orf59	FLJ20625	chromosome 11 open reading frame 59	Two-hybrid	BioGRID	16169070
C11orf79	FLJ20487	chromosome 11 open reading frame 79	Two-hybrid	BioGRID	16169070
C4B	C4A \| C4A13 \| C4A91 \| C4B1 \| C4B12 \| C4B2 \| C4B3 \| C4B5 \| C4F \| CH \| CO4 \| CPAMD3 \| FLJ60561 \| MGC164979	complement component 4B (Childo blood group)	-	HPRD,BioGRID	10851272
CCDC130	MGC10471	coiled-coil domain containing 130	Two-hybrid	BioGRID	16169070
CCL18	AMAC-1 \| AMAC1 \| CKb7 \| DC-CK1 \| DCCK1 \| MIP-4 \| PARC \| SCYA18	chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated)	Two-hybrid	BioGRID	16169070
CKS2	CKSHS2	CDC28 protein kinase regulatory subunit 2	Two-hybrid	BioGRID	16169070
COX17	MGC104397 \| MGC117386	COX17 cytochrome c oxidase assembly homolog (S. cerevisiae)	Two-hybrid	BioGRID	16169070
CRADD	MGC9163 \| RAIDD	CASP2 and RIPK1 domain containing adaptor with death domain	Two-hybrid	BioGRID	16169070
CRCT1	C1orf42 \| NICE-1	cysteine-rich C-terminal 1	Two-hybrid	BioGRID	16169070
DARS	DKFZp781B11202 \| MGC111579	aspartyl-tRNA synthetase	-	HPRD,BioGRID	7806521
DLEU1	BCMS \| DLB1 \| DLEU2 \| LEU1 \| LEU2 \| MGC22430 \| NCRNA00021 \| XTP6	deleted in lymphocytic leukemia 1 (non-protein coding)	Two-hybrid	BioGRID	16169070
DYNLL1	DLC1 \| DLC8 \| DNCL1 \| DNCLC1 \| LC8 \| LC8a \| MGC126137 \| MGC126138 \| PIN \| hdlc1	dynein, light chain, LC8-type 1	Two-hybrid	BioGRID	16169070
EIF3F	EIF3S5 \| eIF3-p47	eukaryotic translation initiation factor 3, subunit F	Two-hybrid	BioGRID	16169070
EXOSC4	FLJ20591 \| RRP41 \| RRP41A \| Rrp41p \| SKI6 \| Ski6p \| hRrp41p \| p12A	exosome component 4	-	HPRD,BioGRID	15231747
FAS	ALPS1A \| APO-1 \| APT1 \| CD95 \| FAS1 \| FASTM \| TNFRSF6	Fas (TNF receptor superfamily, member 6)	Two-hybrid	BioGRID	16169070
HBXIP	MGC71071 \| XIP	hepatitis B virus x interacting protein	Two-hybrid	BioGRID	16169070
HSPE1	CPN10 \| GROES \| HSP10	heat shock 10kDa protein 1 (chaperonin 10)	Two-hybrid	BioGRID	16169070
ITSN1	ITSN \| MGC134948 \| MGC134949 \| SH3D1A \| SH3P17	intersectin 1 (SH3 domain protein)	Two-hybrid	BioGRID	16169070
KIF1B	CMT2 \| CMT2A \| CMT2A1 \| FLJ23699 \| HMSNII \| KIAA0591 \| KIAA1448 \| KLP \| MGC134844	kinesin family member 1B	Two-hybrid	BioGRID	16169070
LAMA4	DKFZp686D23145 \| LAMA3 \| LAMA4*-1	laminin, alpha 4	Two-hybrid	BioGRID	16169070
LSM3	SMX4 \| USS2 \| YLR438C	LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)	Two-hybrid	BioGRID	16169070
MAD2L1BP	CMT2 \| KIAA0110 \| MGC11282 \| RP1-261G23.6	MAD2L1 binding protein	Two-hybrid	BioGRID	16169070
MAP3K7	TAK1 \| TGF1a	mitogen-activated protein kinase kinase kinase 7	-	HPRD	14743216
MLLT3	AF9 \| FLJ2035 \| YEATS3	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	Two-hybrid	BioGRID	16169070
MNAT1	MAT1 \| RNF66 \| TFB3	menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)	Two-hybrid	BioGRID	16169070
MRPL42	HSPC204 \| MRP-L31 \| MRPL31 \| MRPS32 \| PTD007 \| RPML31	mitochondrial ribosomal protein L42	Two-hybrid	BioGRID	16169070
NEU1	FLJ93471 \| NANH \| NEU \| SIAL1	sialidase 1 (lysosomal sialidase)	Two-hybrid	BioGRID	16169070
ORMDL3	-	ORM1-like 3 (S. cerevisiae)	Two-hybrid	BioGRID	16169070
PAEP	GD \| GdA \| GdF \| GdS \| MGC138509 \| MGC142288 \| PAEG \| PEP \| PP14	progestagen-associated endometrial protein	Two-hybrid	BioGRID	16169070
PAFAH1B3	-	platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa	Two-hybrid	BioGRID	16169070
PAPSS1	ATPSK1 \| PAPSS \| SK1	3'-phosphoadenosine 5'-phosphosulfate synthase 1	Two-hybrid	BioGRID	16169070
PCDHA4	CNR1 \| CNRN1 \| CRNR1 \| MGC138307 \| MGC142169 \| PCDH-ALPHA4	protocadherin alpha 4	Two-hybrid	BioGRID	16169070
PFN2	D3S1319E \| PFL	profilin 2	Two-hybrid	BioGRID	16169070
PHYHIP	DYRK1AP3 \| KIAA0273 \| PAHX-AP \| PAHXAP1	phytanoyl-CoA 2-hydroxylase interacting protein	Two-hybrid	BioGRID	16169070
PLAUR	CD87 \| UPAR \| URKR	plasminogen activator, urokinase receptor	Two-hybrid	BioGRID	16169070
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	-	HPRD,BioGRID	11886851
POLE2	DPE2	polymerase (DNA directed), epsilon 2 (p59 subunit)	Two-hybrid	BioGRID	16169070
POLR2C	RPB3 \| RPB31 \| hRPB33 \| hsRPB3	polymerase (RNA) II (DNA directed) polypeptide C, 33kDa	Two-hybrid	BioGRID	16169070
PQBP1	MRX55 \| MRXS3 \| MRXS8 \| NPW38 \| RENS1 \| SHS	polyglutamine binding protein 1	Two-hybrid	BioGRID	16169070
PSG9	PSG11 \| PSGII	pregnancy specific beta-1-glycoprotein 9	Two-hybrid	BioGRID	16169070
PSMD11	MGC3844 \| Rpn6 \| S9 \| p44.5	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	Two-hybrid	BioGRID	16169070
PTPN4	PTPMEG \| PTPMEG1	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	Two-hybrid	BioGRID	16169070
PTPRCAP	CD45-AP \| LPAP \| MGC138602 \| MGC138603	protein tyrosine phosphatase, receptor type, C-associated protein	Two-hybrid	BioGRID	16169070
RAB27A	GS2 \| HsT18676 \| MGC117246 \| RAB27 \| RAM	RAB27A, member RAS oncogene family	Two-hybrid	BioGRID	16169070
RFC5	MGC1155 \| RFC36	replication factor C (activator 1) 5, 36.5kDa	Two-hybrid	BioGRID	16169070
RNF10	KIAA0262 \| MGC126758 \| MGC126764 \| RIE2	ring finger protein 10	Two-hybrid	BioGRID	16169070
RPA2	REPA2 \| RPA32	replication protein A2, 32kDa	Two-hybrid	BioGRID	16169070
RPLP1	FLJ27448 \| MGC5215 \| P1 \| RPP1	ribosomal protein, large, P1	Two-hybrid	BioGRID	16169070
RSRC1	BM-011 \| MGC12197	arginine/serine-rich coiled-coil 1	Two-hybrid	BioGRID	16169070
SARS2	FLJ20450 \| SARS \| SARSM \| SERS \| SYS \| SerRSmt \| mtSerRS	seryl-tRNA synthetase 2, mitochondrial	-	HPRD	15109557
SERPINB9	CAP-3 \| CAP3 \| PI9	serpin peptidase inhibitor, clade B (ovalbumin), member 9	Two-hybrid	BioGRID	16169070
SSR1	DKFZp781N23103 \| FLJ14232 \| FLJ22100 \| FLJ23034 \| FLJ78242 \| FLJ93042 \| TRAPA	signal sequence receptor, alpha	Two-hybrid	BioGRID	16169070
STMN2	SCG10 \| SCGN10 \| SGC10	stathmin-like 2	Two-hybrid	BioGRID	16169070
SULT1E1	EST \| EST-1 \| MGC34459 \| STE	sulfotransferase family 1E, estrogen-preferring, member 1	Two-hybrid	BioGRID	16169070
TAF9	AD-004 \| AK6 \| CGI-137 \| CINAP \| CIP \| MGC1603 \| MGC3647 \| MGC5067 \| MGC:1603 \| MGC:3647 \| MGC:5067 \| TAF2G \| TAFII31 \| TAFII32 \| TAFIID32	TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa	Two-hybrid	BioGRID	16169070
TGIF1	HPE4 \| MGC39747 \| MGC5066 \| TGIF	TGFB-induced factor homeobox 1	Two-hybrid	BioGRID	16169070
TMPRSS3	DFNB10 \| DFNB8 \| ECHOS1 \| TADG12	transmembrane protease, serine 3	Two-hybrid	BioGRID	16169070
TP53BP2	53BP2 \| ASPP2 \| BBP \| PPP1R13A \| p53BP2	tumor protein p53 binding protein, 2	Two-hybrid	BioGRID	16169070
TPT1	FLJ27337 \| HRF \| TCTP \| p02	tumor protein, translationally-controlled 1	-	HPRD	14623968
TRADD	Hs.89862 \| MGC11078	TNFRSF1A-associated via death domain	-	HPRD	14743216
TRDMT1	DNMT2 \| M.HsaIIP \| PuMet \| RNMT1	tRNA aspartic acid methyltransferase 1	Two-hybrid	BioGRID	16169070
TTR	HsT2651 \| PALB \| TBPA	transthyretin	Two-hybrid	BioGRID	16169070
UBQLN4	A1U \| C1orf6 \| CIP75 \| UBIN	ubiquilin 4	Two-hybrid	BioGRID	16169070
VARS	G7A \| VARS1 \| VARS2	valyl-tRNA synthetase	-	HPRD,BioGRID	2556394 \|3169261
WARS	GAMMA-2 \| IFI53 \| IFP53	tryptophanyl-tRNA synthetase	WRS interacts with EF-1-alpha.	BIND	11829477
XPO5	FLJ14239 \| FLJ32057 \| FLJ45606 \| KIAA1291	exportin 5	-	HPRD,BioGRID	12426393
XRN2	-	5'-3' exoribonuclease 2	-	HPRD,BioGRID	15231747
ZCCHC10	FLJ20094	zinc finger, CCHC domain containing 10	Two-hybrid	BioGRID	16169070
ZNF24	KOX17 \| RSG-A \| ZNF191 \| ZSCAN3 \| Zfp191	zinc finger protein 24	Two-hybrid	BioGRID	16169070
ZNF259	MGC110983 \| ZPR1	zinc finger protein 259	-	HPRD,BioGRID	9852145

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME TRANSLATION	222	75	All SZGR 2.0 genes in this pathway
REACTOME PEPTIDE CHAIN ELONGATION	153	41	All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF PROTEINS	518	242	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE UP	108	67	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN	116	79	All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN	384	230	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 2HR UP	27	19	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 6HR UP	55	34	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR DN	214	133	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 DN	67	43	All SZGR 2.0 genes in this pathway
VANHARANTA UTERINE FIBROID WITH 7Q DELETION DN	36	23	All SZGR 2.0 genes in this pathway
JOHANSSON GLIOMAGENESIS BY PDGFB UP	58	44	All SZGR 2.0 genes in this pathway
MATTIOLI MGUS VS PCL	116	62	All SZGR 2.0 genes in this pathway
DIRMEIER LMP1 RESPONSE EARLY	66	48	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP	414	287	All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING DN	35	24	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
ALCALA APOPTOSIS	88	60	All SZGR 2.0 genes in this pathway
COLIN PILOCYTIC ASTROCYTOMA VS GLIOBLASTOMA UP	35	32	All SZGR 2.0 genes in this pathway
NADLER OBESITY DN	48	34	All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND UP	77	52	All SZGR 2.0 genes in this pathway
NGUYEN NOTCH1 TARGETS DN	86	67	All SZGR 2.0 genes in this pathway
MA MYELOID DIFFERENTIATION UP	39	29	All SZGR 2.0 genes in this pathway
MUNSHI MULTIPLE MYELOMA UP	81	52	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX UP	83	66	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR DN	56	37	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
JIANG AGING HYPOTHALAMUS DN	40	31	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
MODY HIPPOCAMPUS PRENATAL	42	33	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX DN	88	58	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL	311	205	All SZGR 2.0 genes in this pathway
ZAMORA NOS2 TARGETS DN	96	71	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
KIM LRRC3B TARGETS	30	24	All SZGR 2.0 genes in this pathway
LEIN LOCALIZED TO PROXIMAL DENDRITES	37	26	All SZGR 2.0 genes in this pathway
EHLERS ANEUPLOIDY UP	41	29	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
CHAUHAN RESPONSE TO METHOXYESTRADIOL DN	102	65	All SZGR 2.0 genes in this pathway
HSIAO HOUSEKEEPING GENES	389	245	All SZGR 2.0 genes in this pathway
IRITANI MAD1 TARGETS DN	47	30	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE DN	181	97	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN	150	99	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN	841	431	All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP	682	440	All SZGR 2.0 genes in this pathway
WIERENGA PML INTERACTOME	42	23	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 UP	140	94	All SZGR 2.0 genes in this pathway
BILANGES SERUM AND RAPAMYCIN SENSITIVE GENES	68	35	All SZGR 2.0 genes in this pathway
BILANGES SERUM RESPONSE TRANSLATION	37	20	All SZGR 2.0 genes in this pathway
ALFANO MYC TARGETS	239	156	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-33	116	122	m8	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	116	122	m8	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-382	235	241	m8	hsa-miR-382^brain	GAAGUUGUUCGUGGUGGAUUCG
miR-542-3p	253	259	1A	hsa-miR-542-3p	UGUGACAGAUUGAUAACUGAAA
miR-543	148	154	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EEF1A1