Gene Page: SEMA3D

Summary ?
GeneID223117
SymbolSEMA3D
SynonymsSema-Z2|coll-2
Descriptionsemaphorin 3D
ReferenceMIM:609907|HGNC:HGNC:10726|Ensembl:ENSG00000153993|HPRD:15321|Vega:OTTHUMG00000154569
Gene typeprotein-coding
Map location7q21.11
Pascal p-value0.056
Fetal beta-1.908

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0016020membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG AXON GUIDANCE 129103All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN 232154All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A DN 9061All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 16521023All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442892All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769437All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037673All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL 254164All SZGR 2.0 genes in this pathway
RAY TUMORIGENESIS BY ERBB2 CDC25A UP 10457All SZGR 2.0 genes in this pathway
MCMURRAY TP53 HRAS COOPERATION RESPONSE DN 6746All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT UP 166105All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR UP 6144All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549316All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP 364236All SZGR 2.0 genes in this pathway
NABA ECM AFFILIATED 17189All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753411All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028559All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-15/16/195/424/497278427911A,m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-342173017361Ahsa-miR-342brainUCUCACACAGAAAUCGCACCCGUC
miR-377162416301Ahsa-miR-377AUCACACAAAGGCAACUUUUGU
miR-503278527911Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG