SZGR2

Summary ?

GeneID	2258
Symbol	FGF13
Synonyms	FGF-13\|FGF2\|FHF-2\|FHF2
Description	fibroblast growth factor 13
Reference	MIM:300070\|HGNC:HGNC:3670\|Ensembl:ENSG00000129682\|HPRD:02090\|Vega:OTTHUMG00000022532
Gene type	protein-coding
Map location	Xq26.3
Sherlock p-value	0.555
DEG p-value	DEG:Zhao_2015:p=1.30e-04:q=0.0733
Fetal beta	0.273
eGene	Myers' cis & trans
Support	Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
DEG:Zhao_2015	RNA Sequencing analysis	Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder.
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs1874981	chr3	7172720	FGF13	2258		0.07		trans
rs737714	chr7	9187293	FGF13	2258		0.18		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MAGED1	0.88	0.91
BRWD2	0.87	0.90
PTPN9	0.87	0.93
BBS1	0.87	0.89
FAM108C1	0.86	0.90
SALL2	0.86	0.86
RPN2	0.86	0.93
TRO	0.86	0.90
ZMYM3	0.86	0.90
DCP1B	0.85	0.89

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-CO2	-0.76	-0.83
AF347015.27	-0.75	-0.83
AF347015.8	-0.74	-0.82
AF347015.31	-0.73	-0.81
AF347015.21	-0.73	-0.85
AF347015.33	-0.72	-0.79
MT-CYB	-0.71	-0.79
FXYD1	-0.69	-0.76
AF347015.15	-0.68	-0.78
AF347015.2	-0.68	-0.79

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		12244047
GO:0008083	growth factor activity	TAS		8790420
GO:0030295	protein kinase activator activity	IGI		12244047
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	TAS	neurite (GO term level: 5)	8790420
GO:0000165	MAPKKK cascade	IDA		12244047
GO:0007267	cell-cell signaling	TAS		8790420
GO:0007165	signal transduction	TAS		8790420
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IDA		8790420
GO:0005737	cytoplasm	IPI		12244047

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG REGULATION OF ACTIN CYTOSKELETON	216	144	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG MELANOMA	71	57	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP	285	181	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
SAMOLS TARGETS OF KHSV MIRNAS DN	62	35	All SZGR 2.0 genes in this pathway
PIEPOLI LGI1 TARGETS UP	15	11	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP	177	110	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP DN	199	124	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN	537	339	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
PASTURAL RIZ1 TARGETS UP	11	5	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN	232	154	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 3 4WK UP	214	144	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
STREICHER LSM1 TARGETS UP	44	34	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS	205	145	All SZGR 2.0 genes in this pathway
MATTIOLI MULTIPLE MYELOMA SUBGROUPS	16	7	All SZGR 2.0 genes in this pathway
LA MEN1 TARGETS	24	15	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS DN	193	112	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP	769	437	All SZGR 2.0 genes in this pathway
TONG INTERACT WITH PTTG1	57	32	All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER E	89	44	All SZGR 2.0 genes in this pathway
BENPORATH ES 1	379	235	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
ROSS AML WITH PML RARA FUSION	77	62	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED DN	246	180	All SZGR 2.0 genes in this pathway
NOUZOVA TRETINOIN AND H4 ACETYLATION	143	85	All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN	153	120	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN	298	200	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN	178	121	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5	482	296	All SZGR 2.0 genes in this pathway
YEGNASUBRAMANIAN PROSTATE CANCER	128	60	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP	578	341	All SZGR 2.0 genes in this pathway
DE YY1 TARGETS DN	92	64	All SZGR 2.0 genes in this pathway
ZHENG IL22 SIGNALING DN	42	26	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 12	30	20	All SZGR 2.0 genes in this pathway
VALK AML WITH T 8 21 TRANSLOCATION	5	5	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP	176	110	All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT UP	166	105	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR DN	91	56	All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS UP	163	111	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL DN	428	246	All SZGR 2.0 genes in this pathway
LIM MAMMARY LUMINAL MATURE UP	116	65	All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS	344	197	All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED	753	411	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-142-5p	516	522	m8	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-142-5p	516	522	m8	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-381	1228	1234	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-452	423	429	1A	hsa-miR-452	UGUUUGCAGAGGAAACUGAGAC
miR-486	1168	1174	m8	hsa-miR-486	UCCUGUACUGAGCUGCCCCGAG
miR-493-5p	1166	1172	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-505	51	57	1A	hsa-miR-505	GUCAACACUUGCUGGUUUCCUC
miR-539	788	794	m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU
miR-539	788	794	m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: FGF13