Gene Page: SYT11
Summary ?
| GeneID | 23208 |
| Symbol | SYT11 |
| Synonyms | SYT12|sytXI |
| Description | synaptotagmin 11 |
| Reference | MIM:608741|HGNC:HGNC:19239|Ensembl:ENSG00000132718|HPRD:12289|Vega:OTTHUMG00000014105 |
| Gene type | protein-coding |
| Map location | 1q21.2 |
| Sherlock p-value | 0.039 |
| DEG p-value | DEG:Sanders_2014:DS1_p=0.155:DS1_beta=0.027900:DS2_p=8.53e-02:DS2_beta=0.086:DS2_FDR=2.70e-01 |
| Fetal beta | -1.436 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DEG:Sanders_2013 | Microarray | Whole-genome gene expression profiles using microarrays on lymphoblastoid cell lines (LCLs) from 413 cases and 446 controls. | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
| Expression | Meta-analysis of gene expression | P value: 1.455 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg25446086 | 1 | 155829549 | SYT11 | 9.22E-9 | -0.016 | 4.15E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0005215 | transporter activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006810 | transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008021 | synaptic vesicle | IEA | Synap, Neurotransmitter (GO term level: 12) | - |
| GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
| GO:0016020 | membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | IEA | - | |
| GO:0030054 | cell junction | IEA | - | |
| GO:0031410 | cytoplasmic vesicle | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ZHONG RESPONSE TO AZACITIDINE AND TSA UP | 183 | 119 | All SZGR 2.0 genes in this pathway |
| DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC2 TARGETS DN | 133 | 77 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS G UP | 238 | 135 | All SZGR 2.0 genes in this pathway |
| KOBAYASHI RESPONSE TO ROMIDEPSIN | 19 | 14 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM6 | 46 | 32 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
| SASAKI ADULT T CELL LEUKEMIA | 176 | 122 | All SZGR 2.0 genes in this pathway |
| AFFAR YY1 TARGETS UP | 214 | 133 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR DN | 101 | 70 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| LEIN OLIGODENDROCYTE MARKERS | 74 | 53 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER T4 | 94 | 69 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER P4 | 100 | 62 | All SZGR 2.0 genes in this pathway |
| GAVIN PDE3B TARGETS | 22 | 15 | All SZGR 2.0 genes in this pathway |
| HELLER SILENCED BY METHYLATION DN | 105 | 67 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
| WALLACE PROSTATE CANCER RACE UP | 299 | 167 | All SZGR 2.0 genes in this pathway |
| CHUNG BLISTER CYTOTOXICITY UP | 134 | 84 | All SZGR 2.0 genes in this pathway |
| FIRESTEIN CTNNB1 PATHWAY | 33 | 23 | All SZGR 2.0 genes in this pathway |
| SENGUPTA EBNA1 ANTICORRELATED | 173 | 85 | All SZGR 2.0 genes in this pathway |
| KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| GREGORY SYNTHETIC LETHAL WITH IMATINIB | 145 | 83 | All SZGR 2.0 genes in this pathway |
| PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
| FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| LE NEURONAL DIFFERENTIATION UP | 18 | 13 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
| GUILLAUMOND KLF10 TARGETS UP | 51 | 39 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| let-7/98 | 2950 | 2957 | 1A,m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
| hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
| hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
| hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
| hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
| hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
| hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
| hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
| hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
| miR-124.1 | 2617 | 2623 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-186 | 3473 | 3479 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-19 | 3117 | 3124 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.