SZGR2

Summary ?

GeneID	23312
Symbol	DMXL2
Synonyms	PEPNS\|RC3
Description	Dmx like 2
Reference	MIM:612186\|HGNC:HGNC:2938\|Ensembl:ENSG00000104093\|HPRD:10188\|Vega:OTTHUMG00000131749
Gene type	protein-coding
Map location	15q21.2
Pascal p-value	0.027
eGene	Cerebellar Hemisphere
Support	G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AARS	0.91	0.87
C16orf5	0.90	0.89
GPI	0.88	0.88
SYN1	0.87	0.90
CAMKK1	0.87	0.88
PPP1R3F	0.87	0.88
TMEM130	0.87	0.88
PELI3	0.87	0.89
CTSD	0.86	0.85
LIMK1	0.86	0.83

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
FAM159B	-0.49	-0.62
RP9P	-0.46	-0.46
IL32	-0.46	-0.33
GNG11	-0.44	-0.31
AC135724.1	-0.43	-0.44
SPINK8	-0.43	-0.43
AL050337.1	-0.43	-0.33
AF347015.21	-0.42	-0.17
AC087071.1	-0.42	-0.31
NSBP1	-0.42	-0.39

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003743	translation initiation factor activity	IEA		-
GO:0017137	Rab GTPase binding	IDA		11809763
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006413	translational initiation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008021	synaptic vesicle	IDA	Synap, Neurotransmitter (GO term level: 12)	11809763
GO:0045202	synapse	IEA	neuron, Synap, Neurotransmitter, Glial (GO term level: 2)	-
GO:0016020	membrane	IEA		-
GO:0030054	cell junction	IEA		-
GO:0031410	cytoplasmic vesicle	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN	463	290	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP	177	110	All SZGR 2.0 genes in this pathway
GAL LEUKEMIC STEM CELL DN	244	153	All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN	384	230	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP	85	54	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP	182	110	All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING DN	58	35	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 AND CD2 DN	51	32	All SZGR 2.0 genes in this pathway
HASLINGER B CLL WITH 11Q23 DELETION	23	18	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED UP	183	111	All SZGR 2.0 genes in this pathway
YAGI AML SURVIVAL	129	87	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3	720	440	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 DN	315	201	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF UP	418	282	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP	408	276	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12	317	177	All SZGR 2.0 genes in this pathway
VALK AML WITH EVI1	25	15	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE S	162	86	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP	397	206	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN	229	135	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-138	1043	1049	1A	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-153	917	923	m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-181	838	844	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-19	618	625	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	618	625	1A,m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-193	857	863	m8	hsa-miR-193a	AACUGGCCUACAAAGUCCCAG
miR-193	857	863	m8	hsa-miR-193b	AACUGGCCCUCAAAGUCCCGCUUU
miR-205	218	225	1A,m8	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-214	526	533	1A,m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-27	1149	1155	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1149	1155	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-30-5p	1038	1044	m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-33	597	603	1A	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	597	603	1A	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-363	586	592	1A	hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
miR-381	908	914	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-496	1162	1168	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-543	1072	1078	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-543	1072	1078	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DMXL2