SZGR2

Summary ?

GeneID	23332
Symbol	CLASP1
Synonyms	MAST1
Description	cytoplasmic linker associated protein 1
Reference	MIM:605852\|HGNC:HGNC:17088\|Ensembl:ENSG00000074054\|HPRD:09322\|Vega:OTTHUMG00000153331
Gene type	protein-coding
Map location	2q14.2-q14.3
Pascal p-value	0.139
Sherlock p-value	0.882
Fetal beta	0.909
DMG	2 (# studies)
Support	CompositeSet Darnell FMRP targets Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	3
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	3
GSMA_I	Genome scan meta-analysis	Psr: 0.023
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00755

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg20340149	2	122407145	CLASP1	1.066E-4	-0.209	0.028	DMG:Wockner_2014
cg14574905	2	122176293	CLASP1	3.483E-4	0.358	0.041	DMG:Wockner_2014
cg01297674	2	122406765	CLASP1	3.03E-9	-0.017	2.09E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SNX17	0.87	0.90
C20orf29	0.87	0.86
RPUSD3	0.86	0.84
ACTR1B	0.86	0.85
RHBDD2	0.85	0.88
UBL7	0.85	0.86
ABHD14A	0.85	0.84
TRUB2	0.84	0.87
P4HTM	0.84	0.84
C20orf30	0.84	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
EIF5B	-0.57	-0.64
AC010300.1	-0.49	-0.57
AC005921.3	-0.48	-0.66
AF347015.18	-0.47	-0.32
NSBP1	-0.45	-0.42
ANP32C	-0.43	-0.45
ZNF326	-0.39	-0.35
AC100783.1	-0.39	-0.31
HSP90AB4P	-0.38	-0.42
SFRS18	-0.38	-0.52

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		15631994 \|17342765
GO:0051010	microtubule plus-end binding	IDA		12837247
GO:0043515	kinetochore binding	IMP		12837247
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001578	microtubule bundle formation	IMP		12837247
GO:0007026	negative regulation of microtubule depolymerization	IGI		15631994
GO:0007026	negative regulation of microtubule depolymerization	IMP		16866869
GO:0007163	establishment or maintenance of cell polarity	NAS		15928712
GO:0007049	cell cycle	IEA		-
GO:0007067	mitosis	IEA		-
GO:0010458	exit from mitosis	IMP		16866869
GO:0051301	cell division	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000777	condensed chromosome kinetochore	IEA		-
GO:0005794	Golgi apparatus	IDA		15631994
GO:0005828	kinetochore microtubule	TAS		12837247
GO:0005856	cytoskeleton	IEA		-
GO:0005881	cytoplasmic microtubule	IDA		11290329
GO:0005737	cytoplasm	IEA		-
GO:0030981	cortical microtubule cytoskeleton	IDA		12837247
GO:0031592	centrosomal corona	IDA		16914514

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE	421	253	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE MITOTIC	325	185	All SZGR 2.0 genes in this pathway
REACTOME RECRUITMENT OF MITOTIC CENTROSOME PROTEINS AND COMPLEXES	66	43	All SZGR 2.0 genes in this pathway
REACTOME LOSS OF NLP FROM MITOTIC CENTROSOMES	59	38	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ROBO RECEPTOR	30	26	All SZGR 2.0 genes in this pathway
REACTOME MITOTIC M M G1 PHASES	172	98	All SZGR 2.0 genes in this pathway
REACTOME MITOTIC G2 G2 M PHASES	81	50	All SZGR 2.0 genes in this pathway
REACTOME DNA REPLICATION	192	110	All SZGR 2.0 genes in this pathway
REACTOME MITOTIC PROMETAPHASE	87	51	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA UP	294	178	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
LUI THYROID CANCER PAX8 PPARG UP	44	29	All SZGR 2.0 genes in this pathway
LUI THYROID CANCER CLUSTER 1	51	33	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
ULE SPLICING VIA NOVA2	43	38	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6	153	112	All SZGR 2.0 genes in this pathway
OUILLETTE CLL 13Q14 DELETION UP	74	40	All SZGR 2.0 genes in this pathway
CHENG IMPRINTED BY ESTRADIOL	110	68	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 9 11 TRANSLOCATION	130	87	All SZGR 2.0 genes in this pathway
WINNEPENNINCKX MELANOMA METASTASIS UP	162	86	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
LINSLEY MIR16 TARGETS	206	127	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-135	229	235	1A	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	229	235	1A	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-181	161	168	1A,m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-194	2918	2924	1A	hsa-miR-194	UGUAACAGCAACUCCAUGUGGA
miR-200bc/429	115	121	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-214	256	263	1A,m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-219	110	116	1A	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-320	133	139	m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-323	2999	3005	m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-370	1844	1850	1A	hsa-miR-370^brain	GCCUGCUGGGGUGGAACCUGG
miR-493-5p	2978	2984	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-494	2950	2956	1A	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CLASP1