Gene Page: SEC14L2
Summary ?
GeneID | 23541 |
Symbol | SEC14L2 |
Synonyms | C22orf6|SPF|TAP|TAP1 |
Description | SEC14 like lipid binding 2 |
Reference | MIM:607558|HGNC:HGNC:10699|Ensembl:ENSG00000100003|HPRD:06344|Vega:OTTHUMG00000151024 |
Gene type | protein-coding |
Map location | 22q12.2 |
Pascal p-value | 0.004 |
Sherlock p-value | 0.623 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ACTR1A | 0.92 | 0.91 |
RPN1 | 0.91 | 0.91 |
YWHAQ | 0.91 | 0.91 |
ARF4 | 0.91 | 0.91 |
CCT5 | 0.91 | 0.91 |
C7orf70 | 0.90 | 0.88 |
ATP5A1 | 0.90 | 0.88 |
MRPL3 | 0.90 | 0.90 |
NIPSNAP1 | 0.89 | 0.90 |
SLC25A17 | 0.89 | 0.89 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MT-CO2 | -0.73 | -0.78 |
AF347015.8 | -0.72 | -0.78 |
AF347015.33 | -0.72 | -0.78 |
AF347015.27 | -0.70 | -0.77 |
AF347015.31 | -0.70 | -0.75 |
MT-CYB | -0.70 | -0.75 |
AF347015.2 | -0.68 | -0.77 |
AF347015.21 | -0.68 | -0.77 |
AF347015.15 | -0.68 | -0.76 |
FXYD1 | -0.68 | -0.77 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005543 | phospholipid binding | NAS | 7364757 | |
GO:0005215 | transporter activity | IEA | - | |
GO:0008431 | vitamin E binding | NAS | 10829015 | |
GO:0016563 | transcription activator activity | NAS | 11444841 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006350 | transcription | IEA | - | |
GO:0006810 | transport | IEA | - | |
GO:0045893 | positive regulation of transcription, DNA-dependent | NAS | 11444841 | |
GO:0045540 | regulation of cholesterol biosynthetic process | NAS | 11226224 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | NAS | 11444841 | |
GO:0005737 | cytoplasm | NAS | 10829015 | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID DELTA NP63 PATHWAY | 47 | 34 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN UP | 184 | 125 | All SZGR 2.0 genes in this pathway |
LIU LIVER CANCER | 38 | 18 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER METASTASIS UP | 56 | 31 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
SU LIVER | 55 | 32 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS UP | 388 | 234 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER SURVIVAL UP | 185 | 112 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
AGUIRRE PANCREATIC CANCER COPY NUMBER DN | 238 | 145 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G123 DN | 51 | 30 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP | 176 | 110 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS PROLIFERATION DN | 179 | 97 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 6HR UP | 229 | 149 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS DN | 242 | 146 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS NOT VIA AKT1 UP | 211 | 131 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS VIA AKT1 UP | 281 | 183 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA VIA KDM3A | 53 | 34 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-125/351 | 359 | 365 | 1A | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.