Gene Page: OSBP2
Summary ?
| GeneID | 23762 |
| Symbol | OSBP2 |
| Synonyms | HLM|ORP-4|ORP4|OSBPL1|OSBPL4 |
| Description | oxysterol binding protein 2 |
| Reference | MIM:606729|HGNC:HGNC:8504|Ensembl:ENSG00000184792|HPRD:09471|Vega:OTTHUMG00000151153 |
| Gene type | protein-coding |
| Map location | 22q12.2 |
| Pascal p-value | 0.004 |
| eGene | Cerebellum Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008202 | steroid metabolic process | IEA | - | |
| GO:0006869 | lipid transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| SHEN SMARCA2 TARGETS DN | 357 | 212 | All SZGR 2.0 genes in this pathway |
| LEE CALORIE RESTRICTION NEOCORTEX UP | 83 | 66 | All SZGR 2.0 genes in this pathway |
| BILD MYC ONCOGENIC SIGNATURE | 206 | 117 | All SZGR 2.0 genes in this pathway |
| NAKAMURA METASTASIS MODEL DN | 43 | 28 | All SZGR 2.0 genes in this pathway |
| VALK AML CLUSTER 7 | 28 | 16 | All SZGR 2.0 genes in this pathway |
| VALK AML CLUSTER 8 | 26 | 17 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| WIERENGA STAT5A TARGETS UP | 217 | 131 | All SZGR 2.0 genes in this pathway |
| WIERENGA STAT5A TARGETS GROUP1 | 136 | 76 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 1327 | 1333 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 1327 | 1333 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-137 | 844 | 850 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
| miR-31 | 463 | 470 | 1A,m8 | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
| miR-410 | 978 | 984 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.