Gene Page: FUT8
Summary ?
| GeneID | 2530 |
| Symbol | FUT8 |
| Synonyms | - |
| Description | fucosyltransferase 8 (alpha (1,6) fucosyltransferase) |
| Reference | MIM:602589|HGNC:HGNC:4019|Ensembl:ENSG00000033170|HPRD:03994|Vega:OTTHUMG00000142818 |
| Gene type | protein-coding |
| Map location | 14q24.3 |
| Pascal p-value | 0.381 |
| Sherlock p-value | 0.623 |
| Fetal beta | -0.207 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg08074084 | 14 | 65880369 | FUT8 | 7.4E-9 | -0.01 | 3.67E-6 | DMG:Jaffe_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs2729048 | chr3 | 602688 | FUT8 | 2530 | 0.19 | trans | ||
| rs6530123 | chrX | 7951068 | FUT8 | 2530 | 0.09 | trans | ||
| rs874294 | chrX | 7957468 | FUT8 | 2530 | 0.09 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016757 | transferase activity, transferring glycosyl groups | IEA | - | |
| GO:0008424 | glycoprotein 6-alpha-L-fucosyltransferase activity | TAS | 11698403 | |
| GO:0017124 | SH3 domain binding | IEA | - | |
| GO:0046921 | alpha(1,6)-fucosyltransferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0043112 | receptor metabolic process | IEA | Neurotransmitter (GO term level: 4) | - |
| GO:0001701 | in utero embryonic development | NAS | 11698403 | |
| GO:0006491 | N-glycan processing | TAS | 11698403 | |
| GO:0007229 | integrin-mediated signaling pathway | IEA | - | |
| GO:0007179 | transforming growth factor beta receptor signaling pathway | IEA | - | |
| GO:0007585 | respiratory gaseous exchange | IEA | - | |
| GO:0009312 | oligosaccharide biosynthetic process | TAS | 9133635 | |
| GO:0042355 | L-fucose catabolic process | NAS | 11698403 | |
| GO:0016477 | cell migration | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005794 | Golgi apparatus | NAS | 11698403 | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG N GLYCAN BIOSYNTHESIS | 46 | 31 | All SZGR 2.0 genes in this pathway |
| KEGG GLYCOSAMINOGLYCAN BIOSYNTHESIS KERATAN SULFATE | 15 | 11 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF PROTEINS | 518 | 242 | All SZGR 2.0 genes in this pathway |
| REACTOME POST TRANSLATIONAL PROTEIN MODIFICATION | 188 | 116 | All SZGR 2.0 genes in this pathway |
| REACTOME ASPARAGINE N LINKED GLYCOSYLATION | 81 | 54 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSPORT TO THE GOLGI AND SUBSEQUENT MODIFICATION | 33 | 24 | All SZGR 2.0 genes in this pathway |
| REACTOME N GLYCAN ANTENNAE ELONGATION IN THE MEDIAL TRANS GOLGI | 18 | 14 | All SZGR 2.0 genes in this pathway |
| LIU SOX4 TARGETS UP | 137 | 94 | All SZGR 2.0 genes in this pathway |
| TURASHVILI BREAST DUCTAL CARCINOMA VS LOBULAR NORMAL UP | 73 | 50 | All SZGR 2.0 genes in this pathway |
| HUTTMANN B CLL POOR SURVIVAL DN | 60 | 39 | All SZGR 2.0 genes in this pathway |
| WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
| LEE NEURAL CREST STEM CELL DN | 118 | 79 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS CDC25 UP | 58 | 39 | All SZGR 2.0 genes in this pathway |
| CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS UP | 126 | 72 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| LANDIS ERBB2 BREAST TUMORS 324 UP | 150 | 93 | All SZGR 2.0 genes in this pathway |
| MISSIAGLIA REGULATED BY METHYLATION DN | 122 | 67 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| WEI MIR34A TARGETS | 148 | 97 | All SZGR 2.0 genes in this pathway |
| LE EGR2 TARGETS DN | 108 | 84 | All SZGR 2.0 genes in this pathway |
| TARTE PLASMA CELL VS B LYMPHOCYTE UP | 78 | 51 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER METASTASIS UP | 56 | 31 | All SZGR 2.0 genes in this pathway |
| HASLINGER B CLL WITH 11Q23 DELETION | 23 | 18 | All SZGR 2.0 genes in this pathway |
| BROWN MYELOID CELL DEVELOPMENT DN | 129 | 86 | All SZGR 2.0 genes in this pathway |
| KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
| YAMAZAKI TCEB3 TARGETS UP | 175 | 116 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
| SANSOM APC MYC TARGETS | 217 | 138 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER WITH H3K27ME3 UP | 295 | 149 | All SZGR 2.0 genes in this pathway |
| MITSIADES RESPONSE TO APLIDIN DN | 249 | 165 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
| WAGNER APO2 SENSITIVITY | 25 | 14 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
| LEE RECENT THYMIC EMIGRANT | 227 | 128 | All SZGR 2.0 genes in this pathway |
| HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
| WENDT COHESIN TARGETS UP | 33 | 19 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA CD1 DN | 45 | 30 | All SZGR 2.0 genes in this pathway |
| KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
| HIRSCH CELLULAR TRANSFORMATION SIGNATURE UP | 242 | 159 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| JUBAN TARGETS OF SPI1 AND FLI1 UP | 115 | 73 | All SZGR 2.0 genes in this pathway |
| HUANG GATA2 TARGETS UP | 149 | 96 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| ROESSLER LIVER CANCER METASTASIS UP | 107 | 72 | All SZGR 2.0 genes in this pathway |
| DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-122 | 460 | 466 | 1A | hsa-miR-122a | UGGAGUGUGACAAUGGUGUUUGU |
| miR-34/449 | 296 | 303 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
| miR-342 | 335 | 342 | 1A,m8 | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
| miR-377 | 334 | 340 | m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
| miR-494 | 683 | 689 | m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.