Gene Page: NGEF
Summary ?
GeneID | 25791 |
Symbol | NGEF |
Synonyms | ARHGEF27|EPHEXIN |
Description | neuronal guanine nucleotide exchange factor |
Reference | MIM:605991|HGNC:HGNC:7807|Ensembl:ENSG00000066248|HPRD:10442|Vega:OTTHUMG00000133272 |
Gene type | protein-coding |
Map location | 2q37 |
Pascal p-value | 7.285E-12 |
Sherlock p-value | 0.901 |
Fetal beta | -2.541 |
DMG | 1 (# studies) |
eGene | Meta |
Support | G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
CV:Ripke_2013 | Genome-wide Association Study | Multi-stage GWAS, Sweden population and PGC2. 24 leading SNPs | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
LK:YES | Genome-wide Association Study | This data set included 99 genes mapped to the 22 regions. The 24 leading SNPs were also included in CV:Ripke_2013 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg06828015 | 2 | 233793120 | NGEF | 2.59E-8 | -0.017 | 8.28E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005089 | Rho guanyl-nucleotide exchange factor activity | IEA | - | |
GO:0005085 | guanyl-nucleotide exchange factor activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | IEA | neurite (GO term level: 5) | - |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
GO:0035023 | regulation of Rho protein signal transduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0042995 | cell projection | IEA | axon (GO term level: 4) | - |
GO:0005622 | intracellular | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
PID RHOA REG PATHWAY | 46 | 30 | All SZGR 2.0 genes in this pathway |
PID CDC42 REG PATHWAY | 30 | 22 | All SZGR 2.0 genes in this pathway |
PID EPHA FWDPATHWAY | 34 | 29 | All SZGR 2.0 genes in this pathway |
PID RAC1 REG PATHWAY | 38 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY RHO GTPASES | 113 | 81 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME NRAGE SIGNALS DEATH THROUGH JNK | 43 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME CELL DEATH SIGNALLING VIA NRAGE NRIF AND NADE | 60 | 43 | All SZGR 2.0 genes in this pathway |
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING | 81 | 61 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA1213 SIGNALLING EVENTS | 74 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS CDC25 UP | 58 | 39 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS UP | 126 | 72 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 UP | 120 | 73 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA FOREVER UP | 19 | 13 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
HATADA METHYLATED IN LUNG CANCER DN | 38 | 13 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM6 | 46 | 32 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
HOFFMANN IMMATURE TO MATURE B LYMPHOCYTE UP | 43 | 34 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 0 | 76 | 54 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
BILANGES SERUM SENSITIVE GENES | 90 | 54 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-155 | 758 | 764 | 1A | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
miR-200bc/429 | 240 | 247 | 1A,m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-485-5p | 551 | 557 | m8 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.