Gene Page: GLS2
Summary ?
| GeneID | 27165 |
| Symbol | GLS2 |
| Synonyms | GA|GLS|LGA|hLGA |
| Description | glutaminase 2 |
| Reference | MIM:606365|HGNC:HGNC:29570|Ensembl:ENSG00000135423|HPRD:05901|Vega:OTTHUMG00000140379 |
| Gene type | protein-coding |
| Map location | 12q13.3 |
| Pascal p-value | 0.002 |
| Sherlock p-value | 0.984 |
| Fetal beta | -2.454 |
| Support | G2Cdb.human_mitochondria G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004359 | glutaminase activity | EXP | glutamate (GO term level: 6) | 10620514 |
| GO:0004359 | glutaminase activity | IEA | glutamate (GO term level: 6) | - |
| GO:0004359 | glutaminase activity | TAS | glutamate (GO term level: 6) | 10620514 |
| GO:0005515 | protein binding | IPI | 11163757 | |
| GO:0016787 | hydrolase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006520 | amino acid metabolic process | TAS | 10620514 | |
| GO:0006541 | glutamine metabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005739 | mitochondrion | TAS | 10620514 | |
| GO:0005759 | mitochondrial matrix | EXP | 10620514 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG ALANINE ASPARTATE AND GLUTAMATE METABOLISM | 32 | 26 | All SZGR 2.0 genes in this pathway |
| KEGG ARGININE AND PROLINE METABOLISM | 54 | 39 | All SZGR 2.0 genes in this pathway |
| KEGG NITROGEN METABOLISM | 23 | 16 | All SZGR 2.0 genes in this pathway |
| KEGG PROXIMAL TUBULE BICARBONATE RECLAMATION | 23 | 16 | All SZGR 2.0 genes in this pathway |
| REACTOME GLUTAMATE NEUROTRANSMITTER RELEASE CYCLE | 15 | 13 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF AMINO ACIDS AND DERIVATIVES | 200 | 136 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
| REACTOME NEUROTRANSMITTER RELEASE CYCLE | 34 | 30 | All SZGR 2.0 genes in this pathway |
| REACTOME AMINO ACID SYNTHESIS AND INTERCONVERSION TRANSAMINATION | 17 | 14 | All SZGR 2.0 genes in this pathway |
| PYEON HPV POSITIVE TUMORS UP | 98 | 47 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
| KERLEY RESPONSE TO CISPLATIN UP | 44 | 30 | All SZGR 2.0 genes in this pathway |
| PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE AUGMENTED BY MYC | 108 | 74 | All SZGR 2.0 genes in this pathway |
| AMUNDSON GENOTOXIC SIGNATURE | 105 | 68 | All SZGR 2.0 genes in this pathway |
| PASQUALUCCI LYMPHOMA BY GC STAGE UP | 283 | 177 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER LUMINAL B UP | 172 | 109 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
| MOOTHA HUMAN MITODB 6 2002 | 429 | 260 | All SZGR 2.0 genes in this pathway |
| MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
| CHIANG LIVER CANCER SUBCLASS CTNNB1 DN | 170 | 105 | All SZGR 2.0 genes in this pathway |
| CHIANG LIVER CANCER SUBCLASS UNANNOTATED UP | 85 | 50 | All SZGR 2.0 genes in this pathway |
| CAIRO HEPATOBLASTOMA DN | 267 | 160 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
| QI HYPOXIA | 140 | 96 | All SZGR 2.0 genes in this pathway |
| CHYLA CBFA2T3 TARGETS DN | 242 | 146 | All SZGR 2.0 genes in this pathway |
| SMIRNOV RESPONSE TO IR 6HR UP | 166 | 97 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-503 | 461 | 467 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.