SZGR2

Summary ?

GeneID	2870
Symbol	GRK6
Synonyms	GPRK6
Description	G protein-coupled receptor kinase 6
Reference	MIM:600869\|HGNC:HGNC:4545\|Ensembl:ENSG00000198055\|HPRD:02925\|Vega:OTTHUMG00000163401
Gene type	protein-coding
Map location	5q35
Pascal p-value	0.272
Fetal beta	-0.012

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.0276
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ADAR	0.88	0.90
LARP1	0.87	0.90
EIF2AK4	0.86	0.88
KIAA0100	0.86	0.89
LARP4B	0.86	0.89
MTOR	0.85	0.88
PRDM4	0.85	0.88
HLCS	0.85	0.86
CLCN6	0.85	0.87
KPNA6	0.84	0.88

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.68	-0.68
AF347015.31	-0.66	-0.65
MT-CO2	-0.64	-0.64
HIGD1B	-0.63	-0.63
AF347015.8	-0.63	-0.63
AF347015.2	-0.62	-0.58
C1orf54	-0.61	-0.68
PLA2G5	-0.60	-0.61
FXYD1	-0.60	-0.58
MT-CYB	-0.60	-0.58

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0004871	signal transducer activity	IEA		-
GO:0004703	G-protein coupled receptor kinase activity	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0007165	signal transduction	IEA		-
GO:0008277	regulation of G-protein coupled receptor protein signaling pathway	TAS		8077221
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ADRB2	ADRB2R \| ADRBR \| B2AR \| BAR \| BETA2AR	adrenergic, beta-2-, receptor, surface	-	HPRD,BioGRID	9819198
CHRM3	HM3	cholinergic receptor, muscarinic 3	-	HPRD	11856737
EDNRB	ABCDS \| ETB \| ETBR \| ETRB \| HSCR \| HSCR2	endothelin receptor type B	-	HPRD	9211925
FSHR	FSHRO \| LGR1 \| MGC141667 \| MGC141668 \| ODG1	follicle stimulating hormone receptor	-	HPRD,BioGRID	10379886
GIT1	-	G protein-coupled receptor kinase interacting ArfGAP 1	-	HPRD	9826657
PRSS23	MGC5107 \| SIG13 \| SPUVE \| ZSIG13	protease, serine, 23	Two-hybrid	BioGRID	16169070
RCVRN	RCV1	recoverin	-	HPRD,BioGRID	12507501
RHO	CSNBAD1 \| MGC138309 \| MGC138311 \| OPN2 \| RP4	rhodopsin	-	HPRD	8366096
SNCA	MGC110988 \| NACP \| PARK1 \| PARK4 \| PD1	synuclein, alpha (non A4 component of amyloid precursor)	Biochemical Activity	BioGRID	10852916
SNCB	-	synuclein, beta	Biochemical Activity	BioGRID	10852916
SNCG	BCSG1 \| SR	synuclein, gamma (breast cancer-specific protein 1)	Biochemical Activity	BioGRID	10852916
TBXA2R	TXA2-R	thromboxane A2 receptor	-	HPRD	11504827

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
PID CXCR4 PATHWAY	102	78	All SZGR 2.0 genes in this pathway
HOLLMANN APOPTOSIS VIA CD40 UP	201	125	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS DN	136	94	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP	293	179	All SZGR 2.0 genes in this pathway
ODONNELL METASTASIS DN	24	13	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP	536	340	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
LIAO METASTASIS	539	324	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
SINGH NFE2L2 TARGETS	15	12	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER POOR SURVIVAL DN	22	15	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING	510	309	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 M	216	124	All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION	456	287	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP	271	165	All SZGR 2.0 genes in this pathway
FOSTER KDM1A TARGETS DN	211	119	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	752	758	m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-137	792	798	1A	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-181	225	231	1A	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-19	28	35	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	28	35	1A,m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-22	1	7	1A	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-34/449	600	606	m8	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-409-3p	751	757	m8	hsa-miR-409-3p	CGAAUGUUGCUCGGUGAACCCCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GRK6