SZGR2

Summary ?

GeneID	3159
Symbol	HMGA1
Synonyms	HMG-R\|HMGA1A\|HMGIY
Description	high mobility group AT-hook 1
Reference	MIM:600701\|HGNC:HGNC:5010\|Ensembl:ENSG00000137309\|HPRD:02829\|Vega:OTTHUMG00000014539
Gene type	protein-coding
Map location	6p21
Pascal p-value	0.732
Sherlock p-value	0.532
Fetal beta	0.629
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
GSMA_I	Genome scan meta-analysis	Psr: 0.033
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.04433

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg23193153	6	34192178	HMGA1	3.54E-8	-0.014	1.04E-5	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0003680	AT DNA binding	TAS		10428834
GO:0003700	transcription factor activity	IMP		10428834
GO:0042975	peroxisome proliferator activated receptor binding	IDA		10428834
GO:0030374	ligand-dependent nuclear receptor transcription coactivator activity	IMP		10428834
GO:0046965	retinoid X receptor binding	IDA		10428834
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006337	nucleosome disassembly	TAS		10428834
GO:0006345	loss of chromatin silencing	TAS		10428834
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	TAS		10871404
GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	NAS		15609325
GO:0006461	protein complex assembly	TAS		10428834
GO:0006268	DNA unwinding during replication	NAS		10428834
GO:0019047	provirus integration	EXP		16291214
GO:0019059	initiation of viral infection	EXP		12091904
GO:0045941	positive regulation of transcription	IMP		10428834
GO:0044419	interspecies interaction between organisms	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000785	chromatin	IEA		-
GO:0005829	cytosol	EXP		12228227 \|15479846
GO:0005634	nucleus	IEA		-
GO:0005667	transcription factor complex	TAS		10428834
GO:0005694	chromosome	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ATF2	CRE-BP1 \| CREB2 \| HB16 \| MGC111558 \| TREB7	activating transcription factor 2	-	HPRD,BioGRID	10357819
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	-	HPRD,BioGRID	12665574
ELF1	-	E74-like factor 1 (ets domain transcription factor)	Reconstituted Complex	BioGRID	7862168
EWSR1	EWS	Ewing sarcoma breakpoint region 1	Two-hybrid	BioGRID	16189514
HIPK2	DKFZp686K02111 \| FLJ23711 \| PRO0593	homeodomain interacting protein kinase 2	-	HPRD	11593421
INSR	CD220 \| HHF5	insulin receptor	HMGA1 interacts with INSR locus.	BIND	15924147
IRF1	IRF-1 \| MAR	interferon regulatory factor 1	-	HPRD,BioGRID	10357819
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD,BioGRID	10357819
NFYA	CBF-A \| CBF-B \| FLJ11236 \| HAP2 \| NF-YA	nuclear transcription factor Y, alpha	-	HPRD,BioGRID	9388234
POU3F1	OCT6 \| OTF6 \| SCIP	POU class 3 homeobox 1	-	HPRD,BioGRID	7791781
RNF4	RES4-26 \| SNURF	ring finger protein 4	-	HPRD	10713105
SP1	-	Sp1 transcription factor	-	HPRD,BioGRID	12665574
SUFU	PRO1280 \| SUFUH \| SUFUXL	suppressor of fused homolog (Drosophila)	-	HPRD	14611647

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID IL4 2PATHWAY	65	43	All SZGR 2.0 genes in this pathway
PID MYC ACTIV PATHWAY	79	62	All SZGR 2.0 genes in this pathway
REACTOME HIV INFECTION	207	122	All SZGR 2.0 genes in this pathway
REACTOME HIV LIFE CYCLE	125	69	All SZGR 2.0 genes in this pathway
REACTOME EARLY PHASE OF HIV LIFE CYCLE	21	8	All SZGR 2.0 genes in this pathway
REACTOME HOST INTERACTIONS OF HIV FACTORS	132	81	All SZGR 2.0 genes in this pathway
REACTOME INTERACTIONS OF VPR WITH HOST CELLULAR PROTEINS	33	21	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS DN	309	191	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP	473	314	All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP	305	185	All SZGR 2.0 genes in this pathway
HORIUCHI WTAP TARGETS DN	310	188	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
RHEIN ALL GLUCOCORTICOID THERAPY DN	362	238	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP	238	144	All SZGR 2.0 genes in this pathway
SENESE HDAC2 TARGETS UP	114	66	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP	146	99	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS UP	214	155	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR UP	164	122	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
MARKS ACETYLATED NON HISTONE PROTEINS	15	9	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 15	13	9	All SZGR 2.0 genes in this pathway
ROSTY CERVICAL CANCER PROLIFERATION CLUSTER	140	73	All SZGR 2.0 genes in this pathway
HERNANDEZ MITOTIC ARREST BY DOCETAXEL 2 UP	64	45	All SZGR 2.0 genes in this pathway
XU HGF SIGNALING NOT VIA AKT1 48HR UP	35	20	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
OXFORD RALA OR RALB TARGETS UP	48	23	All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING VIA SMAD4 UP	108	66	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
LIAO METASTASIS	539	324	All SZGR 2.0 genes in this pathway
BENPORATH ES 1	379	235	All SZGR 2.0 genes in this pathway
BENPORATH ES CORE NINE CORRELATED	100	68	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 480 HELA	164	118	All SZGR 2.0 genes in this pathway
MORI MATURE B LYMPHOCYTE DN	75	43	All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN	200	112	All SZGR 2.0 genes in this pathway
SHEPARD BMYB TARGETS	74	41	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN	185	111	All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO UP	205	126	All SZGR 2.0 genes in this pathway
MANALO HYPOXIA DN	289	166	All SZGR 2.0 genes in this pathway
POMEROY MEDULLOBLASTOMA PROGNOSIS DN	43	28	All SZGR 2.0 genes in this pathway
SHIPP DLBCL VS FOLLICULAR LYMPHOMA UP	45	30	All SZGR 2.0 genes in this pathway
PEART HDAC PROLIFERATION CLUSTER DN	76	57	All SZGR 2.0 genes in this pathway
BHATTACHARYA EMBRYONIC STEM CELL	89	60	All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION DN	87	57	All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND UP	77	52	All SZGR 2.0 genes in this pathway
FAELT B CLL WITH VH3 21 UP	44	30	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS RESPONSE	35	28	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN	371	218	All SZGR 2.0 genes in this pathway
LINDVALL IMMORTALIZED BY TERT UP	78	48	All SZGR 2.0 genes in this pathway
YAMAZAKI TCEB3 TARGETS DN	215	132	All SZGR 2.0 genes in this pathway
ZHOU TNF SIGNALING 30MIN	54	36	All SZGR 2.0 genes in this pathway
JACKSON DNMT1 TARGETS UP	77	57	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS PEAK AT 16HR	40	24	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
LEIN MIDBRAIN MARKERS	82	55	All SZGR 2.0 genes in this pathway
LEIN PONS MARKERS	89	59	All SZGR 2.0 genes in this pathway
LEIN MEDULLA MARKERS	81	48	All SZGR 2.0 genes in this pathway
JEPSEN SMRT TARGETS	33	23	All SZGR 2.0 genes in this pathway
DAIRKEE CANCER PRONE RESPONSE BPA E2	118	65	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING	510	309	All SZGR 2.0 genes in this pathway
MATZUK MALE REPRODUCTION SERTOLI	28	23	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
HUPER BREAST BASAL VS LUMINAL DN	59	44	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER POOR SURVIVAL A6	456	285	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
CROONQUIST IL6 DEPRIVATION DN	98	69	All SZGR 2.0 genes in this pathway
CROONQUIST NRAS SIGNALING DN	72	47	All SZGR 2.0 genes in this pathway
ZHAN V1 LATE DIFFERENTIATION GENES DN	15	13	All SZGR 2.0 genes in this pathway
KAPOSI LIVER CANCER MET UP	18	11	All SZGR 2.0 genes in this pathway
WOO LIVER CANCER RECURRENCE UP	105	75	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD2 DN	46	29	All SZGR 2.0 genes in this pathway
DANG MYC TARGETS UP	143	100	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION	456	287	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN	841	431	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN	229	135	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway
DELACROIX RAR TARGETS UP	48	33	All SZGR 2.0 genes in this pathway
VANOEVELEN MYOGENESIS SIN3A TARGETS	220	133	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	960	966	m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-103/107	1178	1185	1A,m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	1178	1185	1A,m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-124.1	435	441	1A	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-138	168	174	m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-142-3p	155	162	1A,m8	hsa-miR-142-3p	UGUAGUGUUUCCUACUUUAUGGA
miR-143	457	463	1A	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-15/16/195/424/497	1019	1025	m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
				hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-196	959	965	m8	hsa-miR-196a	UAGGUAGUUUCAUGUUGUUGG
miR-196	959	965	m8	hsa-miR-196b	UAGGUAGUUUCCUGUUGUUGG
miR-26	1317	1324	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	1317	1324	1A,m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: HMGA1