SZGR2

Summary ?

GeneID	382
Symbol	ARF6
Synonyms	-
Description	ADP ribosylation factor 6
Reference	MIM:600464\|HGNC:HGNC:659\|Ensembl:ENSG00000165527\|HPRD:02714\|Vega:OTTHUMG00000140296
Gene type	protein-coding
Map location	14q21.3
Pascal p-value	0.627
Fetal beta	-0.064
eGene	Cerebellar Hemisphere Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0192

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs11682393	chr2	47804496	ARF6	382		0.1		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003924	GTPase activity	TAS		1993656
GO:0005515	protein binding	IPI		9312003
GO:0005525	GTP binding	TAS		10913182
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001889	liver development	IEA		-
GO:0007155	cell adhesion	TAS		10036235
GO:0006928	cell motion	TAS		10036235
GO:0007264	small GTPase mediated signal transduction	IEA		-
GO:0006915	apoptosis	IEA		-
GO:0016192	vesicle-mediated transport	TAS		10913182
GO:0035020	regulation of Rac protein signal transduction	IDA		10036235
GO:0015031	protein transport	IEA		-
GO:0031529	ruffle organization	IDA		10036235
GO:0048261	negative regulation of receptor-mediated endocytosis	TAS		9312003
GO:0030838	positive regulation of actin filament polymerization	IMP		10036235
GO:0030866	cortical actin cytoskeleton organization	IMP		10913182
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001726	ruffle	IDA		9312003
GO:0005794	Golgi apparatus	IEA		-
GO:0005622	intracellular	IEA		-
GO:0005624	membrane fraction	TAS		8702973
GO:0005737	cytoplasm	IEA		-
GO:0005768	endosome	TAS		10913182
GO:0005938	cell cortex	IDA		10913182
GO:0005886	plasma membrane	IDA		10036235

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AP1B1	ADTB1 \| AP105A \| BAM22 \| CLAPB2	adaptor-related protein complex 1, beta 1 subunit	-	HPRD	11926829
AP3B1	ADTB3 \| ADTB3A \| HPS \| HPS2 \| PE	adaptor-related protein complex 3, beta 1 subunit	Reconstituted Complex	BioGRID	11926829
AP3D1	ADTD \| hBLVR	adaptor-related protein complex 3, delta 1 subunit	-	HPRD	11926829
AP3S2	AP3S3 \| FLJ35955 \| sigma3b	adaptor-related protein complex 3, sigma 2 subunit	Reconstituted Complex	BioGRID	11926829
ARFIP2	POR1	ADP-ribosylation factor interacting protein 2	-	HPRD,BioGRID	9312003
ARRB1	ARB1 \| ARR1	arrestin, beta 1	-	HPRD,BioGRID	11533043 \|11867621
ARRB2	ARB2 \| ARR2 \| BARR2 \| DKFZp686L0365	arrestin, beta 2	-	HPRD,BioGRID	11533043 \|11867621
ASAP2	AMAP2 \| CENTB3 \| DDEF2 \| FLJ42910 \| KIAA0400 \| PAG3 \| PAP \| Pap-alpha \| SHAG1	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	-	HPRD	10022920 \|10749932
CHRM3	HM3	cholinergic receptor, muscarinic 3	-	HPRD,BioGRID	12799371
CYTH2	ARNO \| CTS18 \| CTS18.1 \| PSCD2 \| PSCD2L \| SEC7L \| Sec7p-L \| Sec7p-like	cytohesin 2	-	HPRD,BioGRID	9417041
DHPS	MIG13	deoxyhypusine synthase	Affinity Capture-MS	BioGRID	17353931
DYNC1H1	DHC1 \| DHC1a \| DKFZp686P2245 \| DNCH1 \| DNCL \| DNECL \| DYHC \| Dnchc1 \| HL-3 \| KIAA0325 \| p22	dynein, cytoplasmic 1, heavy chain 1	Affinity Capture-MS	BioGRID	17353931
EIF6	2 \| CAB \| EIF3A \| ITGB4BP \| b \| b(2)gcn \| gcn \| p27BBP	eukaryotic translation initiation factor 6	Affinity Capture-MS	BioGRID	17353931
EPPK1	EPIPL \| EPIPL1	epiplakin 1	Affinity Capture-MS	BioGRID	17353931
EXOC5	DKFZp666H126 \| HSEC10 \| PRO1912 \| SEC10 \| SEC10L1 \| SEC10P	exocyst complex component 5	-	HPRD,BioGRID	14662749
GART	AIRS \| GARS \| GARTF \| MGC47764 \| PAIS \| PGFT \| PRGS	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	Affinity Capture-MS	BioGRID	17353931
IQGAP1	HUMORFA01 \| KIAA0051 \| SAR1 \| p195	IQ motif containing GTPase activating protein 1	Affinity Capture-MS	BioGRID	17353931
KIAA0368	ECM29 \| FLJ22036 \| KIAA1962 \| RP11-386D8.2	KIAA0368	Affinity Capture-MS	BioGRID	17353931
LRPPRC	CLONE-23970 \| GP130 \| LRP130 \| LSFC	leucine-rich PPR-motif containing	Affinity Capture-MS	BioGRID	17353931
PABPC4	APP-1 \| APP1 \| FLJ43938 \| PABP4 \| iPABP	poly(A) binding protein, cytoplasmic 4 (inducible form)	Affinity Capture-MS	BioGRID	17353931
PIP5K1A	-	phosphatidylinositol-4-phosphate 5-kinase, type I, alpha	-	HPRD	10589680
PIP5K1C	KIAA0589 \| LCCS3 \| PIP5K-GAMMA \| PIP5Kgamma	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	-	HPRD,BioGRID	12847086
PLD1	-	phospholipase D1, phosphatidylcholine-specific	-	HPRD,BioGRID	12379803
RAB11FIP3	KIAA0665 \| Rab11-FIP3	RAB11 family interacting protein 3 (class II)	-	HPRD	11535061
RALA	MGC48949 \| RAL	v-ral simian leukemia viral oncogene homolog A (ras related)	Affinity Capture-Western	BioGRID	12509462
YARS	CMTDIC \| TYRRS \| YRS \| YTS	tyrosyl-tRNA synthetase	Affinity Capture-MS	BioGRID	17353931

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS	97	71	All SZGR 2.0 genes in this pathway
PID MET PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID ARF6 TRAFFICKING PATHWAY	49	34	All SZGR 2.0 genes in this pathway
PID ARF6 PATHWAY	35	27	All SZGR 2.0 genes in this pathway
PID ARF6 DOWNSTREAM PATHWAY	15	14	All SZGR 2.0 genes in this pathway
PID PI3KCI PATHWAY	49	40	All SZGR 2.0 genes in this pathway
PID AJDISS 2PATHWAY	48	38	All SZGR 2.0 genes in this pathway
PID ECADHERIN NASCENT AJ PATHWAY	39	33	All SZGR 2.0 genes in this pathway
PID ECADHERIN STABILIZATION PATHWAY	42	34	All SZGR 2.0 genes in this pathway
PID INTEGRIN A4B1 PATHWAY	33	24	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP	423	283	All SZGR 2.0 genes in this pathway
HORIUCHI WTAP TARGETS DN	310	188	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM1	229	137	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
SCIAN INVERSED TARGETS OF TP53 AND TP73 DN	31	23	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 240 HELA	60	43	All SZGR 2.0 genes in this pathway
SUNG METASTASIS STROMA DN	54	34	All SZGR 2.0 genes in this pathway
GOLDRATH HOMEOSTATIC PROLIFERATION	171	102	All SZGR 2.0 genes in this pathway
CHEOK RESPONSE TO HD MTX DN	24	18	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT REJECTED VS OK UP	63	48	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP	555	346	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
XU CREBBP TARGETS DN	44	31	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D4	55	37	All SZGR 2.0 genes in this pathway
JI RESPONSE TO FSH DN	58	43	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP	100	72	All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS UP	198	132	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
HILLION HMGA1B TARGETS	92	68	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP	439	257	All SZGR 2.0 genes in this pathway
LABBE TARGETS OF TGFB1 AND WNT3A DN	108	68	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP	491	316	All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS FIBROBLAST UP	84	60	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP	518	299	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER UP	307	182	All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 3 DN	42	24	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN	553	343	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP	344	215	All SZGR 2.0 genes in this pathway
HOLLEMAN ASPARAGINASE RESISTANCE B ALL DN	15	10	All SZGR 2.0 genes in this pathway
HOLLEMAN ASPARAGINASE RESISTANCE ALL DN	25	14	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-139	425	431	1A	hsa-miR-139^brain	UCUACAGUGCACGUGUCU
miR-23	577	583	m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	577	583	m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-30-3p	485	492	1A,m8	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	485	492	1A,m8	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-323	577	583	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-494	470	476	1A	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ARF6