SZGR2

Summary ?

GeneID	4692
Symbol	NDN
Synonyms	HsT16328\|PWCR
Description	necdin, MAGE family member
Reference	MIM:602117\|HGNC:HGNC:7675\|Ensembl:ENSG00000182636\|HPRD:03667\|Vega:OTTHUMG00000129161
Gene type	protein-coding
Map location	15q11.2
Pascal p-value	0.648
Sherlock p-value	0.65
Fetal beta	-0.054
eGene	Meta

Gene in Data Sources

Gene set name	Method of gene set	Description
CNV:YES	Copy number variation studies	Manual curation
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 6

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
NHP2	0.87	0.85
MRPS24	0.84	0.79
C12orf10	0.83	0.80
AC174470.1	0.83	0.79
GADD45GIP1	0.83	0.80
TOMM5	0.83	0.81
RABAC1	0.82	0.78
POP7	0.82	0.79
EXOSC4	0.82	0.81
CCDC56	0.82	0.79

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.26	-0.61	-0.61
AF347015.2	-0.58	-0.57
AF347015.15	-0.57	-0.58
AF347015.33	-0.57	-0.58
MT-CYB	-0.56	-0.57
AF347015.8	-0.56	-0.56
MT-CO2	-0.52	-0.51
AF347015.18	-0.51	-0.54
AF347015.9	-0.51	-0.56
FAM38A	-0.51	-0.52

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0005515	protein binding	IPI		17353931
GO:0043015	gamma-tubulin binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007417	central nervous system development	IEA	Brain (GO term level: 6)	-
GO:0007413	axonal fasciculation	IEA	neuron, axon (GO term level: 13)	-
GO:0001764	neuron migration	IEA	neuron (GO term level: 8)	-
GO:0048676	axon extension involved in development	IEA	axon (GO term level: 14)	-
GO:0048666	neuron development	IEA	neuron (GO term level: 9)	-
GO:0008347	glial cell migration	IEA	neuron, Glial (GO term level: 8)	-
GO:0001558	regulation of cell growth	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0008285	negative regulation of cell proliferation	TAS		9630521
GO:0007585	respiratory gaseous exchange	IEA		-
GO:0048011	nerve growth factor receptor signaling pathway	IEA		-
GO:0019233	sensory perception of pain	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005813	centrosome	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0043204	perikaryon	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ARSE	CDPX \| CDPX1 \| CDPXR \| MGC163310	arylsulfatase E (chondrodysplasia punctata 1)	Two-hybrid	BioGRID	16169070
AUP1	-	ancient ubiquitous protein 1	Affinity Capture-MS	BioGRID	17353931
DHCR7	SLOS	7-dehydrocholesterol reductase	Affinity Capture-MS	BioGRID	17353931
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	-	HPRD,BioGRID	9422723 \|14593116
E2F4	E2F-4	E2F transcription factor 4, p107/p130-binding	-	HPRD	12198120
HNRNPU	HNRPU \| SAF-A \| U21.1	heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)	-	HPRD,BioGRID	11813259
IL1A	IL-1A \| IL1 \| IL1-ALPHA \| IL1F1	interleukin 1, alpha	-	HPRD,BioGRID	12913118
LASS2	CerS2 \| FLJ10243 \| L3 \| MGC987 \| SP260 \| TMSG1	LAG1 homolog, ceramide synthase 2	Affinity Capture-MS	BioGRID	17353931
NDN	HsT16328 \| PWCR	necdin homolog (mouse)	-	HPRD	12414813
NDN	HsT16328 \| PWCR	necdin homolog (mouse)	Two-hybrid	BioGRID	10915798
NGFR	CD271 \| Gp80-LNGFR \| TNFRSF16 \| p75(NTR) \| p75NTR	nerve growth factor receptor (TNFR superfamily, member 16)	-	HPRD,BioGRID	12414813 \|12716928 \|14593116
NUBP1	MGC117406 \| MGC130052 \| MGC130053 \| NBP \| NBP1	nucleotide binding protein 1 (MinD homolog, E. coli)	-	HPRD,BioGRID	10915798
NUCB2	NEFA	nucleobindin 2	-	HPRD,BioGRID	10915798
PJA1	RNF70	praja 1	-	HPRD,BioGRID	11959851
RPS11	-	ribosomal protein S11	Affinity Capture-MS	BioGRID	17353931
SEC61A1	HSEC61 \| SEC61 \| SEC61A	Sec61 alpha 1 subunit (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
SRPRB	APMCF1	signal recognition particle receptor, B subunit	Affinity Capture-MS	BioGRID	17353931
TMEM33	1600019D15Rik \| FLJ10525 \| SHINC3	transmembrane protein 33	Affinity Capture-MS	BioGRID	17353931
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	10347180

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID P75 NTR PATHWAY	69	51	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP	351	230	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN	663	425	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL DN	86	59	All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN	291	176	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP	316	190	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP DN	199	124	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP	238	135	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK DN	196	131	All SZGR 2.0 genes in this pathway
WONG ENDMETRIUM CANCER DN	82	53	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION APOBEC2	27	19	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 12HR	43	35	All SZGR 2.0 genes in this pathway
JOHANSSON BRAIN CANCER EARLY VS LATE DN	45	35	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM4	261	153	All SZGR 2.0 genes in this pathway
GARCIA TARGETS OF FLI1 AND DAX1 DN	176	104	All SZGR 2.0 genes in this pathway
FRIDMAN SENESCENCE UP	77	60	All SZGR 2.0 genes in this pathway
FRIDMAN IMMORTALIZATION DN	34	24	All SZGR 2.0 genes in this pathway
KANNAN TP53 TARGETS UP	58	40	All SZGR 2.0 genes in this pathway
PEART HDAC PROLIFERATION CLUSTER UP	57	35	All SZGR 2.0 genes in this pathway
POMEROY MEDULLOBLASTOMA PROGNOSIS UP	47	30	All SZGR 2.0 genes in this pathway
GUO HEX TARGETS UP	81	54	All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS DN	234	137	All SZGR 2.0 genes in this pathway
PAL PRMT5 TARGETS UP	203	135	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION MUSCLE UP	43	33	All SZGR 2.0 genes in this pathway
LEE AGING MUSCLE DN	46	29	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS UP	113	71	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
KRASNOSELSKAYA ILF3 TARGETS DN	46	38	All SZGR 2.0 genes in this pathway
TSENG ADIPOGENIC POTENTIAL UP	30	19	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING	510	309	All SZGR 2.0 genes in this pathway
IZADPANAH STEM CELL ADIPOSE VS BONE DN	108	68	All SZGR 2.0 genes in this pathway
SCHRAETS MLL TARGETS UP	35	21	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
LEE INTRATHYMIC T PROGENITOR	21	14	All SZGR 2.0 genes in this pathway
COLINA TARGETS OF 4EBP1 AND 4EBP2	356	214	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP	207	143	All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT UP	166	105	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
NAKAYAMA SOFT TISSUE TUMORS PCA1 DN	74	47	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP	756	494	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP	504	321	All SZGR 2.0 genes in this pathway
BRIDEAU IMPRINTED GENES	63	47	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-200bc/429	92	98	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-217	90	96	1A	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NDN