Gene Page: P4HB
Summary ?
GeneID | 5034 |
Symbol | P4HB |
Synonyms | CLCRP1|DSI|ERBA2L|GIT|P4Hbeta|PDI|PDIA1|PHDB|PO4DB|PO4HB|PROHB |
Description | prolyl 4-hydroxylase subunit beta |
Reference | MIM:176790|HGNC:HGNC:8548|Ensembl:ENSG00000185624|HPRD:07181|Vega:OTTHUMG00000150269 |
Gene type | protein-coding |
Map location | 17q25 |
Pascal p-value | 0.867 |
Sherlock p-value | 1 |
DMG | 1 (# studies) |
eGene | Cerebellum Cortex |
Support | RNA AND PROTEIN SYNTHESIS |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.7758 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg15882999 | 17 | 79818726 | P4HB | -0.02 | 0.76 | DMG:Nishioka_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ICMT | 0.84 | 0.81 |
SPOCK2 | 0.80 | 0.78 |
SLC7A8 | 0.79 | 0.84 |
INPP4B | 0.79 | 0.77 |
PEG3AS | 0.78 | 0.75 |
KIAA1324L | 0.78 | 0.77 |
RNF6 | 0.78 | 0.80 |
SGPP2 | 0.78 | 0.74 |
SRPR | 0.78 | 0.84 |
CYLD | 0.78 | 0.79 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
EMID1 | -0.39 | -0.41 |
KLHL1 | -0.37 | -0.04 |
WDR86 | -0.37 | -0.36 |
SCUBE1 | -0.36 | -0.30 |
SLA | -0.36 | -0.02 |
DACT1 | -0.36 | -0.03 |
TMEM108 | -0.35 | -0.09 |
MPPED1 | -0.35 | -0.13 |
NEUROD2 | -0.35 | -0.14 |
NEUROD6 | -0.34 | -0.17 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003756 | protein disulfide isomerase activity | TAS | 2846539 | |
GO:0005515 | protein binding | IPI | 17055437 |17353931 | |
GO:0004656 | procollagen-proline 4-dioxygenase activity | IDA | 7753822 | |
GO:0016853 | isomerase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0018401 | peptidyl-proline hydroxylation to 4-hydroxy-L-proline | IDA | 7753822 | |
GO:0045454 | cell redox homeostasis | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005792 | microsome | IEA | - | |
GO:0005793 | ER-Golgi intermediate compartment | IDA | 15308636 | |
GO:0005788 | endoplasmic reticulum lumen | IEA | - | |
GO:0005576 | extracellular region | NAS | 14718574 | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0005783 | endoplasmic reticulum | TAS | 3034602 | |
GO:0009986 | cell surface | IDA | 12493773 | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0042470 | melanosome | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
CD2BP2 | FWP010 | LIN1 | Snu40 | U5-52K | CD2 (cytoplasmic tail) binding protein 2 | Affinity Capture-MS | BioGRID | 17353931 |
COL1A1 | OI4 | collagen, type I, alpha 1 | - | HPRD | 1339453 |
COL1A2 | OI4 | collagen, type I, alpha 2 | - | HPRD,BioGRID | 10329688 |
CUL2 | MGC131970 | cullin 2 | Affinity Capture-MS | BioGRID | 17353931 |
EIF4A2 | BM-010 | DDX2B | EIF4A | EIF4F | eukaryotic translation initiation factor 4A, isoform 2 | Affinity Capture-MS | BioGRID | 17353931 |
ELF3 | EPR-1 | ERT | ESE-1 | ESX | E74-like factor 3 (ets domain transcription factor, epithelial-specific ) | Affinity Capture-MS | BioGRID | 17353931 |
ERO1L | ERO1-alpha | ERO1-like (S. cerevisiae) | - | HPRD,BioGRID | 11707400 |
ERO1LB | - | ERO1-like beta (S. cerevisiae) | - | HPRD,BioGRID | 11847130 |
FEZ1 | - | fasciculation and elongation protein zeta 1 (zygin I) | Two-hybrid | BioGRID | 16169070 |
P4HA2 | - | procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II | - | HPRD | 7753822 |
P4HA3 | - | procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III | - | HPRD | 12874193 |14500733 |
PTN | HARP | HBGF8 | HBNF | NEGF1 | pleiotrophin | Two-hybrid | BioGRID | 16169070 |
PUF60 | FIR | FLJ31379 | RoBPI | SIAHBP1 | poly-U binding splicing factor 60KDa | Affinity Capture-MS | BioGRID | 17353931 |
TG | AITD3 | TGN | thyroglobulin | - | HPRD,BioGRID | 10636893 |
TNFRSF14 | ATAR | HVEA | HVEM | LIGHTR | TR2 | tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) | Affinity Capture-MS | BioGRID | 17353931 |
TRIP6 | MGC10556 | MGC10558 | MGC29959 | MGC3837 | MGC4423 | OIP1 | ZRP-1 | thyroid hormone receptor interactor 6 | Affinity Capture-MS | BioGRID | 17353931 |
UBQLN1 | DA41 | DSK2 | FLJ90054 | PLIC-1 | XDRP1 | ubiquilin 1 | - | HPRD,BioGRID | 12095988 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
BIOCARTA HIF PATHWAY | 15 | 12 | All SZGR 2.0 genes in this pathway |
BIOCARTA VITCB PATHWAY | 11 | 6 | All SZGR 2.0 genes in this pathway |
ST INTEGRIN SIGNALING PATHWAY | 82 | 62 | All SZGR 2.0 genes in this pathway |
REACTOME EXTRACELLULAR MATRIX ORGANIZATION | 87 | 42 | All SZGR 2.0 genes in this pathway |
REACTOME COLLAGEN FORMATION | 58 | 31 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
REACTOME LIPID DIGESTION MOBILIZATION AND TRANSPORT | 46 | 37 | All SZGR 2.0 genes in this pathway |
REACTOME LIPOPROTEIN METABOLISM | 28 | 24 | All SZGR 2.0 genes in this pathway |
REACTOME CHYLOMICRON MEDIATED LIPID TRANSPORT | 16 | 15 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
CHOW RASSF1 TARGETS DN | 29 | 19 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER UP | 181 | 108 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 5 | 147 | 89 | All SZGR 2.0 genes in this pathway |
LI LUNG CANCER | 41 | 30 | All SZGR 2.0 genes in this pathway |
LI AMPLIFIED IN LUNG CANCER | 178 | 108 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE AUGMENTED BY MYC | 108 | 74 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
LIEN BREAST CARCINOMA METAPLASTIC | 35 | 25 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE UP | 283 | 177 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS B LYMPHOCYTE UP | 78 | 51 | All SZGR 2.0 genes in this pathway |
ROSS AML WITH PML RARA FUSION | 77 | 62 | All SZGR 2.0 genes in this pathway |
CHEN LUNG CANCER SURVIVAL | 28 | 22 | All SZGR 2.0 genes in this pathway |
SHIPP DLBCL VS FOLLICULAR LYMPHOMA UP | 45 | 30 | All SZGR 2.0 genes in this pathway |
GALE APL WITH FLT3 MUTATED DN | 17 | 10 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS UP | 175 | 116 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY NO BLOOD UP | 222 | 139 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
RAMASWAMY METASTASIS UP | 66 | 43 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
ZHONG SECRETOME OF LUNG CANCER AND FIBROBLAST | 132 | 93 | All SZGR 2.0 genes in this pathway |
CAMPS COLON CANCER COPY NUMBER UP | 92 | 45 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER ERBB2 UP | 147 | 83 | All SZGR 2.0 genes in this pathway |
QI PLASMACYTOMA DN | 100 | 63 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 12 | 30 | 20 | All SZGR 2.0 genes in this pathway |
JISON SICKLE CELL DISEASE UP | 181 | 106 | All SZGR 2.0 genes in this pathway |
NGO MALIGNANT GLIOMA 1P LOH | 17 | 13 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
PECE MAMMARY STEM CELL DN | 146 | 88 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-188 | 201 | 207 | m8 | hsa-miR-188 | CAUCCCUUGCAUGGUGGAGGGU |
miR-204/211 | 200 | 206 | m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.