Gene Page: ATP6V1B2
Summary ?
GeneID | 526 |
Symbol | ATP6V1B2 |
Synonyms | ATP6B1B2|ATP6B2|HO57|VATB|VPP3|Vma2 |
Description | ATPase H+ transporting V1 subunit B2 |
Reference | MIM:606939|HGNC:HGNC:854|Ensembl:ENSG00000147416|HPRD:06088|Vega:OTTHUMG00000131073 |
Gene type | protein-coding |
Map location | 8p21.3 |
Pascal p-value | 0.651 |
Sherlock p-value | 0.894 |
Fetal beta | -1.611 |
eGene | Anterior cingulate cortex BA24 Myers' cis & trans |
Support | ION BALANCE G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs4921718 | chr8 | 20313633 | ATP6V1B2 | 526 | 0.16 | cis | ||
rs67854339 | 8 | 20520376 | ATP6V1B2 | ENSG00000147416.6 | 2.45121E-7 | 0.01 | 465498 | gtex_brain_ba24 |
rs17421112 | 8 | 20525787 | ATP6V1B2 | ENSG00000147416.6 | 5.06624E-8 | 0.01 | 470909 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MDH1 | 0.93 | 0.94 |
HPRT1 | 0.91 | 0.92 |
CCNDBP1 | 0.90 | 0.89 |
GOT1 | 0.90 | 0.92 |
GHITM | 0.89 | 0.93 |
ATG7 | 0.89 | 0.87 |
TMEM111 | 0.89 | 0.91 |
CHN1 | 0.88 | 0.81 |
ANXA7 | 0.88 | 0.83 |
PPP2R4 | 0.87 | 0.90 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SH3BP2 | -0.52 | -0.55 |
SMTN | -0.52 | -0.54 |
FADS2 | -0.51 | -0.43 |
GLIS2 | -0.50 | -0.46 |
FAM59B | -0.49 | -0.46 |
SEMA4B | -0.49 | -0.44 |
CDC42EP4 | -0.49 | -0.47 |
UPF3A | -0.48 | -0.43 |
SH2B2 | -0.47 | -0.48 |
PDE9A | -0.47 | -0.43 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0016787 | hydrolase activity | IEA | - | |
GO:0008553 | hydrogen-exporting ATPase activity, phosphorylative mechanism | IEA | - | |
GO:0046933 | hydrogen ion transporting ATP synthase activity, rotational mechanism | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
GO:0046961 | hydrogen ion transporting ATPase activity, rotational mechanism | TAS | 2145275 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006811 | ion transport | IEA | - | |
GO:0006754 | ATP biosynthetic process | IEA | - | |
GO:0015988 | energy coupled proton transport, against electrochemical gradient | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0012505 | endomembrane system | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016469 | proton-transporting two-sector ATPase complex | IEA | - | |
GO:0042470 | melanosome | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG OXIDATIVE PHOSPHORYLATION | 135 | 73 | All SZGR 2.0 genes in this pathway |
KEGG VIBRIO CHOLERAE INFECTION | 56 | 32 | All SZGR 2.0 genes in this pathway |
KEGG EPITHELIAL CELL SIGNALING IN HELICOBACTER PYLORI INFECTION | 68 | 44 | All SZGR 2.0 genes in this pathway |
REACTOME INSULIN RECEPTOR RECYCLING | 23 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME LATENT INFECTION OF HOMO SAPIENS WITH MYCOBACTERIUM TUBERCULOSIS | 33 | 15 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
REACTOME IRON UPTAKE AND TRANSPORT | 36 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSFERRIN ENDOCYTOSIS AND RECYCLING | 25 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY INSULIN RECEPTOR | 108 | 72 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID UP | 25 | 18 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA PROGENITOR UP | 39 | 25 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF UP | 215 | 137 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS A UP | 191 | 128 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
RICKMAN METASTASIS DN | 261 | 155 | All SZGR 2.0 genes in this pathway |
SWEET KRAS TARGETS DN | 66 | 39 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL CIS | 128 | 77 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
BROWN MYELOID CELL DEVELOPMENT UP | 165 | 100 | All SZGR 2.0 genes in this pathway |
ALCALAY AML BY NPM1 LOCALIZATION UP | 140 | 83 | All SZGR 2.0 genes in this pathway |
MODY HIPPOCAMPUS POSTNATAL | 63 | 50 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR UP | 180 | 125 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D5 | 39 | 26 | All SZGR 2.0 genes in this pathway |
GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C1 | 72 | 45 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN | 274 | 165 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS DN | 210 | 128 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
AGUIRRE PANCREATIC CANCER COPY NUMBER DN | 238 | 145 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
ZHAN V1 LATE DIFFERENTIATION GENES UP | 32 | 25 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 AND SATB1 DN | 180 | 116 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 1149 | 1155 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-130/301 | 62 | 68 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-141/200a | 145 | 151 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-19 | 61 | 67 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-23 | 1241 | 1247 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 1241 | 1247 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-543 | 1271 | 1277 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.