Gene Page: PRKAB1
Summary ?
GeneID | 5564 |
Symbol | PRKAB1 |
Synonyms | AMPK|HAMPKb |
Description | protein kinase AMP-activated non-catalytic subunit beta 1 |
Reference | MIM:602740|HGNC:HGNC:9378|Ensembl:ENSG00000111725|HPRD:04116|Vega:OTTHUMG00000168954 |
Gene type | protein-coding |
Map location | 12q24.1-q24.3 |
Pascal p-value | 0.001 |
Fetal beta | 0.41 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.126 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs13291971 | chr9 | 12861064 | PRKAB1 | 5564 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
PDE7B | 0.80 | 0.78 |
INF2 | 0.79 | 0.74 |
FBXL16 | 0.78 | 0.77 |
IL17RA | 0.77 | 0.77 |
SMAD3 | 0.76 | 0.79 |
SLC6A1 | 0.75 | 0.85 |
STIM1 | 0.75 | 0.77 |
AGFG2 | 0.75 | 0.75 |
ACTN1 | 0.74 | 0.71 |
RAP1GAP | 0.73 | 0.66 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RPL24 | -0.48 | -0.59 |
RPS3AP47 | -0.47 | -0.55 |
RPL31 | -0.46 | -0.57 |
RPL27 | -0.46 | -0.56 |
RPL35A | -0.46 | -0.61 |
C12orf45 | -0.46 | -0.54 |
RPS23 | -0.46 | -0.57 |
RPS20 | -0.46 | -0.61 |
EXOSC8 | -0.46 | -0.50 |
C9orf46 | -0.45 | -0.54 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 18403135 | |
GO:0004553 | hydrolase activity, hydrolyzing O-glycosyl compounds | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005975 | carbohydrate metabolic process | IEA | - | |
GO:0007165 | signal transduction | TAS | 9575201 | |
GO:0006633 | fatty acid biosynthetic process | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IDA | 18029348 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ACLY | ACL | ATPCL | CLATP | ATP citrate lyase | Affinity Capture-MS | BioGRID | 17353931 |
DHX36 | DDX36 | G4R1 | KIAA1488 | MLEL1 | RHAU | DEAH (Asp-Glu-Ala-His) box polypeptide 36 | Affinity Capture-MS | BioGRID | 17353931 |
EZR | CVIL | CVL | DKFZp762H157 | FLJ26216 | MGC1584 | VIL2 | ezrin | Affinity Capture-MS | BioGRID | 17353931 |
F10 | FX | FXA | coagulation factor X | Two-hybrid | BioGRID | 16169070 |
FNIP1 | DKFZp686E18167 | DKFZp781P0215 | KIAA1961 | MGC667 | folliculin interacting protein 1 | Affinity Capture-Western | BioGRID | 17028174 |
GYS1 | GSY | GYS | glycogen synthase 1 (muscle) | Affinity Capture-MS | BioGRID | 17353931 |
MARS | FLJ35667 | METRS | MTRNS | methionyl-tRNA synthetase | Affinity Capture-MS | BioGRID | 17353931 |
MYH10 | MGC134913 | MGC134914 | NMMHCB | myosin, heavy chain 10, non-muscle | Affinity Capture-MS | BioGRID | 17353931 |
NDUFA7 | B14.5a | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa | Two-hybrid | BioGRID | 16169070 |
PRKAB2 | MGC61468 | protein kinase, AMP-activated, beta 2 non-catalytic subunit | Affinity Capture-MS | BioGRID | 17353931 |
PRKAG1 | AMPKG | MGC8666 | protein kinase, AMP-activated, gamma 1 non-catalytic subunit | - | HPRD,BioGRID | 10698692 |
PRKAG2 | AAKG | AAKG2 | CMH6 | H91620p | WPWS | protein kinase, AMP-activated, gamma 2 non-catalytic subunit | - | HPRD,BioGRID | 10698692 |
SNRNP200 | ASCC3L1 | BRR2 | HELIC2 | U5-200KD | small nuclear ribonucleoprotein 200kDa (U5) | Affinity Capture-MS | BioGRID | 17353931 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
KEGG ADIPOCYTOKINE SIGNALING PATHWAY | 67 | 57 | All SZGR 2.0 genes in this pathway |
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM | 85 | 65 | All SZGR 2.0 genes in this pathway |
BIOCARTA CHREBP2 PATHWAY | 42 | 35 | All SZGR 2.0 genes in this pathway |
BIOCARTA LEPTIN PATHWAY | 11 | 11 | All SZGR 2.0 genes in this pathway |
PID LKB1 PATHWAY | 47 | 37 | All SZGR 2.0 genes in this pathway |
PID P53 DOWNSTREAM PATHWAY | 137 | 94 | All SZGR 2.0 genes in this pathway |
PID VEGFR1 2 PATHWAY | 69 | 57 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATED AMPK STIMULATES FATTY ACID OXIDATION IN MUSCLE | 19 | 16 | All SZGR 2.0 genes in this pathway |
REACTOME INSULIN RECEPTOR SIGNALLING CASCADE | 87 | 64 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF AMPK ACTIVITY VIA LKB1 | 15 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME ENERGY DEPENDENT REGULATION OF MTOR BY LKB1 AMPK | 18 | 15 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF RHEB GTPASE ACTIVITY BY AMPK | 10 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME PKB MEDIATED EVENTS | 29 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY INSULIN RECEPTOR | 108 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME PI3K CASCADE | 71 | 51 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 2 UP | 139 | 83 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS UP | 293 | 179 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
KANNAN TP53 TARGETS UP | 58 | 40 | All SZGR 2.0 genes in this pathway |
WESTON VEGFA TARGETS 6HR | 59 | 38 | All SZGR 2.0 genes in this pathway |
WESTON VEGFA TARGETS | 108 | 71 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY 4NQO OR UV | 63 | 44 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE DN | 195 | 135 | All SZGR 2.0 genes in this pathway |
AMBROSINI FLAVOPIRIDOL TREATMENT TP53 | 109 | 63 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
NICK RESPONSE TO PROC TREATMENT DN | 27 | 18 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS UNANNOTATED DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM AND NORMAL AGING UP | 93 | 62 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 9 | 76 | 45 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
SMIRNOV RESPONSE TO IR 6HR UP | 166 | 97 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-137 | 704 | 710 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-539 | 748 | 754 | m8 | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.