Gene Page: CCDC88A
Summary ?
| GeneID | 55704 |
| Symbol | CCDC88A |
| Synonyms | APE|GIRDIN|GIV|GRDN|HkRP1|KIAA1212 |
| Description | coiled-coil domain containing 88A |
| Reference | MIM:609736|HGNC:HGNC:25523|Ensembl:ENSG00000115355|HPRD:10051|HPRD:11131|Vega:OTTHUMG00000151915 |
| Gene type | protein-coding |
| Map location | 2p16.1 |
| Pascal p-value | 0.064 |
| Fetal beta | 1.006 |
| eGene | Cerebellar Hemisphere |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenics,schizophrenias | Click to show details |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.1667 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HDAC3 | 0.95 | 0.94 |
| BAT1 | 0.94 | 0.93 |
| FANCG | 0.93 | 0.90 |
| DAXX | 0.93 | 0.93 |
| ZNF7 | 0.92 | 0.92 |
| FAM48A | 0.92 | 0.91 |
| VPS16A | 0.92 | 0.93 |
| ZSCAN21 | 0.92 | 0.90 |
| USF1 | 0.92 | 0.94 |
| SSRP1 | 0.92 | 0.91 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.27 | -0.79 | -0.90 |
| AF347015.31 | -0.78 | -0.88 |
| MT-CO2 | -0.77 | -0.88 |
| AF347015.33 | -0.76 | -0.86 |
| MT-CYB | -0.76 | -0.87 |
| AF347015.8 | -0.75 | -0.88 |
| AIFM3 | -0.74 | -0.77 |
| AF347015.15 | -0.74 | -0.87 |
| HLA-F | -0.73 | -0.74 |
| AF347015.2 | -0.72 | -0.88 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003779 | actin binding | IDA | 16139227 | |
| GO:0008017 | microtubule binding | ISS | - | |
| GO:0042803 | protein homodimerization activity | IPI | 16139227 | |
| GO:0035091 | phosphoinositide binding | IDA | 16139227 | |
| GO:0043422 | protein kinase B binding | IPI | 16139227 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001932 | regulation of protein amino acid phosphorylation | ISS | - | |
| GO:0016044 | membrane organization | IDA | 15882442 | |
| GO:0006275 | regulation of DNA replication | ISS | - | |
| GO:0016477 | cell migration | IMP | 16139227 | |
| GO:0042127 | regulation of cell proliferation | ISS | - | |
| GO:0032956 | regulation of actin cytoskeleton organization | IMP | 16139227 | |
| GO:0032148 | activation of protein kinase B activity | ISS | - | |
| GO:0030032 | lamellipodium biogenesis | IMP | 16139227 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005794 | Golgi apparatus | IDA | 15882442 | |
| GO:0005829 | cytosol | IDA | 15749703 | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0005783 | endoplasmic reticulum | IDA | 15882442 | |
| GO:0030027 | lamellipodium | IDA | 16139227 | |
| GO:0005886 | plasma membrane | IDA | 15882442 | |
| GO:0031410 | cytoplasmic vesicle | IDA | 15882442 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
| PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| HADDAD T LYMPHOCYTE AND NK PROGENITOR UP | 78 | 56 | All SZGR 2.0 genes in this pathway |
| MCCLUNG CREB1 TARGETS DN | 57 | 39 | All SZGR 2.0 genes in this pathway |
| TSENG IRS1 TARGETS DN | 135 | 88 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS 11 | 57 | 40 | All SZGR 2.0 genes in this pathway |
| DURCHDEWALD SKIN CARCINOGENESIS DN | 264 | 168 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
| BOYLAN MULTIPLE MYELOMA D CLUSTER DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
| BOYLAN MULTIPLE MYELOMA D DN | 78 | 34 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 36HR DN | 185 | 116 | All SZGR 2.0 genes in this pathway |
| POOLA INVASIVE BREAST CANCER UP | 288 | 168 | All SZGR 2.0 genes in this pathway |
| BOYLAN MULTIPLE MYELOMA PCA3 DN | 69 | 38 | All SZGR 2.0 genes in this pathway |
| CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
| GUTIERREZ CHRONIC LYMPHOCYTIC LEUKEMIA DN | 56 | 39 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE G2 M | 216 | 124 | All SZGR 2.0 genes in this pathway |
| BILANGES SERUM SENSITIVE VIA TSC2 | 39 | 25 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 AND SATB1 DN | 180 | 116 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 2736 | 2742 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-128 | 2646 | 2652 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-129-5p | 1081 | 1087 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| miR-130/301 | 2986 | 2992 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
| hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
| hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
| hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
| miR-144 | 2735 | 2742 | 1A,m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-18 | 2605 | 2611 | m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
| hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
| miR-181 | 479 | 485 | 1A | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
| hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
| hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
| hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
| miR-182 | 219 | 225 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-19 | 1924 | 1931 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-203.1 | 3123 | 3129 | m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
| miR-218 | 1076 | 1083 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-378 | 2718 | 2725 | 1A,m8 | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
| miR-431 | 88 | 94 | 1A | hsa-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
| miR-488 | 2747 | 2753 | 1A | hsa-miR-488 | CCCAGAUAAUGGCACUCUCAA |
| miR-495 | 1051 | 1057 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
| miR-539 | 55 | 61 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
| miR-93.hd/291-3p/294/295/302/372/373/520 | 2988 | 2994 | 1A | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
| hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
| hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
| hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
| hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
| hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
| hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
| hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
| hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
| hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
| hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
| hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU | ||||
| miR-96 | 219 | 225 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.