SZGR2

Summary ?

GeneID	55818
Symbol	KDM3A
Synonyms	JHDM2A\|JHMD2A\|JMJD1\|JMJD1A\|TSGA
Description	lysine demethylase 3A
Reference	MIM:611512\|HGNC:HGNC:20815\|Ensembl:ENSG00000115548\|HPRD:11054\|Vega:OTTHUMG00000130204
Gene type	protein-coding
Map location	2p11.2
Pascal p-value	0.584
Sherlock p-value	0.077
DEG p-value	DEG:Maycox_2009:CC_BA10_fold_change=1.14:CC_BA10_disease_P=0.0008:HBB_BA9_fold_change=1.20:HBB_BA9_disease_P=0.0062
Fetal beta	0.383
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	Chromatin Remodeling Genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DEG:Maycox_2009	Microarray to determine the expression of over 30000 mRNA transcripts in post-mortem tissue	We included 51 genes whose expression changes are common between two schizophrenia cohorts.
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg02386983	2	86669112	KDM3A	3.47E-8	-0.007	1.03E-5	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs997135	chr20	12330295	KDM3A	55818		0.17		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005506	iron ion binding	IMP		16603237
GO:0008270	zinc ion binding	IEA		-
GO:0016702	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	IEA		-
GO:0016491	oxidoreductase activity	IEA		-
GO:0046872	metal ion binding	IEA		-
GO:0050681	androgen receptor binding	IDA		16603237
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0009755	hormone-mediated signaling	IDA		16603237
GO:0016568	chromatin modification	IEA		-
GO:0033169	histone H3-K9 demethylation	IDA		16603237
GO:0030521	androgen receptor signaling pathway	IDA		16603237
GO:0045941	positive regulation of transcription	IMP		16603237
GO:0046293	formaldehyde biosynthetic process	IDA		16603237
GO:0055114	oxidation reduction	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IDA		16603237

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID AR PATHWAY	61	46	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA DN	136	86	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE DN	384	220	All SZGR 2.0 genes in this pathway
PRAMOONJAGO SOX4 TARGETS UP	52	38	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP	95	64	All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN	240	171	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN	459	276	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA UP	171	112	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA BY DMOG UP	130	85	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP	769	437	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS	290	172	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS	179	105	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN	185	111	All SZGR 2.0 genes in this pathway
MANALO HYPOXIA UP	207	145	All SZGR 2.0 genes in this pathway
MENSE HYPOXIA UP	98	71	All SZGR 2.0 genes in this pathway
NOUZOVA TRETINOIN AND H4 ACETYLATION	143	85	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
LEONARD HYPOXIA	47	35	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP	439	257	All SZGR 2.0 genes in this pathway
CHEN HOXA5 TARGETS 9HR UP	223	132	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G3 UP	188	121	All SZGR 2.0 genes in this pathway
QI HYPOXIA	140	96	All SZGR 2.0 genes in this pathway
QI HYPOXIA TARGETS OF HIF1A AND FOXA2	37	27	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
FARDIN HYPOXIA 11	32	29	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
IKEDA MIR30 TARGETS UP	116	87	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA VIA KDM3A	53	34	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 2HR DN	55	35	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR DN	114	69	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	82	88	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-101	486	492	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-128	206	212	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	206	212	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-136	411	417	m8	hsa-miR-136	ACUCCAUUUGUUUUGAUGAUGGA
miR-144	486	492	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-155	576	582	1A	hsa-miR-155	UUAAUGCUAAUCGUGAUAGGGG
miR-216	70	76	m8	hsa-miR-216	UAAUCUCAGCUGGCAACUGUG
miR-22	29	35	m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-224	209	215	m8	hsa-miR-224	CAAGUCACUAGUGGUUCCGUUUA
miR-27	206	212	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	206	212	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-30-5p	148	155	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-544	474	480	1A	hsa-miR-544	AUUCUGCAUUUUUAGCAAGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: KDM3A