Gene Page: TWSG1
Summary ?
| GeneID | 57045 |
| Symbol | TWSG1 |
| Synonyms | TSG |
| Description | twisted gastrulation BMP signaling modulator 1 |
| Reference | MIM:605049|HGNC:HGNC:12429|Ensembl:ENSG00000128791|HPRD:05443|Vega:OTTHUMG00000131597 |
| Gene type | protein-coding |
| Map location | 18p11.3 |
| Pascal p-value | 0.002 |
| Sherlock p-value | 0.277 |
| eGene | Caudate basal ganglia Putamen basal ganglia |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs8093378 | 18 | 9336740 | TWSG1 | ENSG00000128791.7 | 2.175E-7 | 0 | 1975 | gtex_brain_putamen_basal |
| rs8093683 | 18 | 9336979 | TWSG1 | ENSG00000128791.7 | 2.162E-7 | 0 | 2214 | gtex_brain_putamen_basal |
| rs62087465 | 18 | 9339057 | TWSG1 | ENSG00000128791.7 | 2.046E-7 | 0 | 4292 | gtex_brain_putamen_basal |
| rs12457923 | 18 | 9339571 | TWSG1 | ENSG00000128791.7 | 2.019E-7 | 0 | 4806 | gtex_brain_putamen_basal |
| rs73399928 | 18 | 9341347 | TWSG1 | ENSG00000128791.7 | 1.92E-7 | 0 | 6582 | gtex_brain_putamen_basal |
| rs12458365 | 18 | 9341733 | TWSG1 | ENSG00000128791.7 | 1.9E-7 | 0 | 6968 | gtex_brain_putamen_basal |
| rs201444092 | 18 | 9341806 | TWSG1 | ENSG00000128791.7 | 1.898E-7 | 0 | 7041 | gtex_brain_putamen_basal |
| rs56396800 | 18 | 9341807 | TWSG1 | ENSG00000128791.7 | 1.896E-7 | 0 | 7042 | gtex_brain_putamen_basal |
| rs12456325 | 18 | 9342066 | TWSG1 | ENSG00000128791.7 | 1.885E-7 | 0 | 7301 | gtex_brain_putamen_basal |
| rs62087466 | 18 | 9343987 | TWSG1 | ENSG00000128791.7 | 1.804E-7 | 0 | 9222 | gtex_brain_putamen_basal |
| rs57333366 | 18 | 9344737 | TWSG1 | ENSG00000128791.7 | 1.772E-7 | 0 | 9972 | gtex_brain_putamen_basal |
| rs113641426 | 18 | 9351874 | TWSG1 | ENSG00000128791.7 | 1.619E-7 | 0 | 17109 | gtex_brain_putamen_basal |
| rs62087468 | 18 | 9352071 | TWSG1 | ENSG00000128791.7 | 1.619E-7 | 0 | 17306 | gtex_brain_putamen_basal |
| rs16954989 | 18 | 9353809 | TWSG1 | ENSG00000128791.7 | 1.592E-7 | 0 | 19044 | gtex_brain_putamen_basal |
| rs16954996 | 18 | 9357199 | TWSG1 | ENSG00000128791.7 | 1.592E-7 | 0 | 22434 | gtex_brain_putamen_basal |
| rs11875065 | 18 | 9357749 | TWSG1 | ENSG00000128791.7 | 1.592E-7 | 0 | 22984 | gtex_brain_putamen_basal |
| rs8088103 | 18 | 9365590 | TWSG1 | ENSG00000128791.7 | 1.488E-7 | 0 | 30825 | gtex_brain_putamen_basal |
| rs56349417 | 18 | 9371163 | TWSG1 | ENSG00000128791.7 | 1.592E-7 | 0 | 36398 | gtex_brain_putamen_basal |
| rs7243117 | 18 | 9381229 | TWSG1 | ENSG00000128791.7 | 3.964E-8 | 0 | 46464 | gtex_brain_putamen_basal |
| rs34741369 | 18 | 9382477 | TWSG1 | ENSG00000128791.7 | 1.592E-7 | 0 | 47712 | gtex_brain_putamen_basal |
| rs9676006 | 18 | 9386121 | TWSG1 | ENSG00000128791.7 | 2.626E-7 | 0 | 51356 | gtex_brain_putamen_basal |
| rs139460418 | 18 | 9386312 | TWSG1 | ENSG00000128791.7 | 1.592E-7 | 0 | 51547 | gtex_brain_putamen_basal |
| rs57456386 | 18 | 9390346 | TWSG1 | ENSG00000128791.7 | 1.592E-7 | 0 | 55581 | gtex_brain_putamen_basal |
| rs9748497 | 18 | 9396995 | TWSG1 | ENSG00000128791.7 | 1.464E-7 | 0 | 62230 | gtex_brain_putamen_basal |
| rs62087494 | 18 | 9397004 | TWSG1 | ENSG00000128791.7 | 1.579E-7 | 0 | 62239 | gtex_brain_putamen_basal |
| rs9748605 | 18 | 9397015 | TWSG1 | ENSG00000128791.7 | 1.474E-7 | 0 | 62250 | gtex_brain_putamen_basal |
| rs7229150 | 18 | 9397172 | TWSG1 | ENSG00000128791.7 | 1.131E-6 | 0 | 62407 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0030900 | forebrain development | IEA | Brain (GO term level: 8) | - |
| GO:0001503 | ossification | IEA | - | |
| GO:0001707 | mesoderm formation | IEA | - | |
| GO:0009790 | embryonic development | IEA | - | |
| GO:0009888 | tissue development | IEA | - | |
| GO:0030154 | cell differentiation | IEA | - | |
| GO:0030513 | positive regulation of BMP signaling pathway | IEA | - | |
| GO:0030514 | negative regulation of BMP signaling pathway | IEA | - | |
| GO:0043010 | camera-type eye development | IEA | - | |
| GO:0030097 | hemopoiesis | IEA | - | |
| GO:0045668 | negative regulation of osteoblast differentiation | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0005615 | extracellular space | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
| SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 3 UP | 329 | 196 | All SZGR 2.0 genes in this pathway |
| BEGUM TARGETS OF PAX3 FOXO1 FUSION UP | 60 | 45 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| ROSS AML WITH AML1 ETO FUSION | 76 | 55 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER P4 | 100 | 62 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
| FUJII YBX1 TARGETS DN | 202 | 132 | All SZGR 2.0 genes in this pathway |
| ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
| SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
| KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124/506 | 439 | 445 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.