SZGR2

Summary ?

GeneID	57787
Symbol	MARK4
Synonyms	MARK4L\|MARK4S\|MARKL1\|MARKL1L\|PAR-1D
Description	microtubule affinity regulating kinase 4
Reference	MIM:606495\|HGNC:HGNC:13538\|Ensembl:ENSG00000007047\|HPRD:09402\|Vega:OTTHUMG00000181769
Gene type	protein-coding
Map location	19q13.3
Pascal p-value	0.183
TADA p-value	0.002
Fetal beta	-0.507
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Montano_2016	Genome-wide DNA methylation analysis	This dataset includes 172 replicated associations between CpGs with schizophrenia.	1
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 6

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
MARK4	chr19	45800933	G	A	NM_001199867 NM_001199867 NM_031417 NM_031417	. . . .	intronic splice-acceptor-in2 intronic splice-acceptor-in2			Schizophrenia	DNM:Fromer_2014

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg14114377	19	45756845	MARK4	1.07E-5	-0.008	0.045	DMG:Montano_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs10994209	chr10	61877705	MARK4	57787		0.19		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
BRMS1L	0.84	0.86
FAM102B	0.83	0.83
OXCT1	0.81	0.81
VAPB	0.81	0.83
EPS15	0.81	0.81
USP12	0.80	0.80
MCFD2	0.80	0.80
SGTB	0.80	0.80
CDC40	0.80	0.78
TRAPPC6B	0.80	0.78

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
EFEMP2	-0.39	-0.46
NUDT8	-0.38	-0.46
NDUFA4L2	-0.38	-0.41
EIF4EBP3	-0.38	-0.42
AF347015.18	-0.37	-0.30
GATSL3	-0.37	-0.43
TMEM88	-0.36	-0.43
MICALL2	-0.35	-0.37
AP003068.3	-0.35	-0.34
SLC38A5	-0.35	-0.42

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0050321	tau-protein kinase activity	IDA	Brain (GO term level: 7)	14594945
GO:0050321	tau-protein kinase activity	ISS	Brain (GO term level: 7)	-
GO:0000166	nucleotide binding	IEA		-
GO:0005515	protein binding	IPI		14594945 \|14676191
GO:0005524	ATP binding	IEA		-
GO:0005524	ATP binding	NAS		15009667
GO:0004674	protein serine/threonine kinase activity	IDA		15009667
GO:0004674	protein serine/threonine kinase activity	IEA		-
GO:0004674	protein serine/threonine kinase activity	ISS		-
GO:0004674	protein serine/threonine kinase activity	NAS		11326310
GO:0004713	protein tyrosine kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0008017	microtubule binding	IDA		14594945
GO:0008017	microtubule binding	ISS		-
GO:0043130	ubiquitin binding	NAS		14594945
GO:0043015	gamma-tubulin binding	IDA		14594945
GO:0043015	gamma-tubulin binding	ISS		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	IDA	neurite (GO term level: 5)	14594945
GO:0007399	nervous system development	ISS	neurite (GO term level: 5)	-
GO:0000082	G1/S transition of mitotic cell cycle	NAS		12735302
GO:0000086	G2/M transition of mitotic cell cycle	NAS		11326310
GO:0001578	microtubule bundle formation	IEP		14594945
GO:0001578	microtubule bundle formation	ISS		-
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0006468	protein amino acid phosphorylation	NAS		11326310
GO:0006468	protein amino acid phosphorylation	TAS		14594945
GO:0016055	Wnt receptor signaling pathway	TAS		11326310
GO:0008284	positive regulation of cell proliferation	IDA		12735302
GO:0043068	positive regulation of programmed cell death	NAS		15009667
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0043005	neuron projection	IDA	neuron, axon, neurite, dendrite (GO term level: 5)	14594945
GO:0043005	neuron projection	ISS	neuron, axon, neurite, dendrite (GO term level: 5)	-
GO:0000930	gamma-tubulin complex	IDA		14594945
GO:0005813	centrosome	IDA		14594945
GO:0005813	centrosome	ISS		-
GO:0005815	microtubule organizing center	IDA		14594945
GO:0005874	microtubule	IDA		14594945
GO:0005737	cytoplasm	IDA		11326310

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTA1	ACTA \| ASMA \| CFTD \| CFTD1 \| CFTDM \| MPFD \| NEM1 \| NEM2 \| NEM3	actin, alpha 1, skeletal muscle	Affinity Capture-MS	BioGRID	14594945
HSPA4	APG-2 \| HS24/P52 \| MGC131852 \| RY \| hsp70 \| hsp70RY	heat shock 70kDa protein 4	Affinity Capture-MS	BioGRID	14594945
MAP2	DKFZp686I2148 \| MAP2A \| MAP2B \| MAP2C	microtubule-associated protein 2	-	HPRD,BioGRID	14594945
MAP4	DKFZp779A1753 \| MGC8617	microtubule-associated protein 4	-	HPRD,BioGRID	14594945
MAPT	DDPAC \| FLJ31424 \| FTDP-17 \| MAPTL \| MGC138549 \| MSTD \| MTBT1 \| MTBT2 \| PPND \| TAU	microtubule-associated protein tau	-	HPRD,BioGRID	14594945
MYH10	MGC134913 \| MGC134914 \| NMMHCB	myosin, heavy chain 10, non-muscle	Affinity Capture-MS	BioGRID	14594945
MYH9	DFNA17 \| EPSTS \| FTNS \| MGC104539 \| MHA \| NMHC-II-A \| NMMHCA	myosin, heavy chain 9, non-muscle	Affinity Capture-MS	BioGRID	14594945
STK11	LKB1 \| PJS	serine/threonine kinase 11	LKB1 phosphorylates MARK4.	BIND	14676191
TUBA1A	B-ALPHA-1 \| FLJ25113 \| LIS3 \| TUBA3	tubulin, alpha 1a	Affinity Capture-MS	BioGRID	14594945
TUBB	M40 \| MGC117247 \| MGC16435 \| OK/SW-cl.56 \| TUBB1 \| TUBB5	tubulin, beta	Affinity Capture-MS	BioGRID	14594945
TUBB2A	TUBB \| TUBB2 \| dJ40E16.7	tubulin, beta 2A	-	HPRD	14594945
TUBG1	TUBG \| TUBGCP1	tubulin, gamma 1	Affinity Capture-MS Affinity Capture-Western	BioGRID	14594945

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID LKB1 PATHWAY	47	37	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP	473	314	All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN	275	168	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP	185	126	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR UP	164	122	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
ROVERSI GLIOMA COPY NUMBER UP	100	75	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM5	94	59	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP	292	168	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING	246	152	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP	221	150	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP	344	215	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-17-5p/20/93.mr/106/519.d	759	765	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-214	95	101	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-24	269	276	1A,m8	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-493-5p	765	771	1A	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MARK4