Gene Page: RGS7
Summary ?
| GeneID | 6000 |
| Symbol | RGS7 |
| Synonyms | - |
| Description | regulator of G-protein signaling 7 |
| Reference | MIM:602517|HGNC:HGNC:10003|Ensembl:ENSG00000182901|HPRD:03948|Vega:OTTHUMG00000040107 |
| Gene type | protein-coding |
| Map location | 1q43|1q23.1 |
| Sherlock p-value | 0.729 |
| Fetal beta | -1.413 |
| DMG | 1 (# studies) |
| Support | GPCR SIGNALLING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.4707 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg07944863 | 1 | 241520789 | RGS7 | 4.66E-7 | -0.431 | 0.006 | DMG:Wockner_2014 |
| cg02395863 | 1 | 241298215 | RGS7 | 1.77E-4 | 0.268 | 0.034 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004871 | signal transducer activity | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0016299 | regulator of G-protein signaling activity | NAS | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
| GO:0009968 | negative regulation of signal transduction | IEA | - | |
| GO:0007242 | intracellular signaling cascade | IEA | - | |
| GO:0008277 | regulation of G-protein coupled receptor protein signaling pathway | NAS | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005834 | heterotrimeric G-protein complex | IEA | - | |
| GO:0005575 | cellular_component | ND | - | |
| GO:0005634 | nucleus | IDA | 18029348 | |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005730 | nucleolus | IDA | 18029348 | |
| GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA I SIGNALLING EVENTS | 195 | 114 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER BASAL VS MESENCHYMAL DN | 50 | 36 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS 8HR DN | 129 | 84 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| CHEN LIVER METABOLISM QTL CIS | 93 | 40 | All SZGR 2.0 genes in this pathway |
| SETLUR PROSTATE CANCER TMPRSS2 ERG FUSION DN | 20 | 12 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-145 | 348 | 355 | 1A,m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
| miR-30-3p | 326 | 333 | 1A,m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
| hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.