Gene Page: LIN7B
Summary ?
| GeneID | 64130 |
| Symbol | LIN7B |
| Synonyms | LIN-7B|MALS-2|MALS2|VELI2 |
| Description | lin-7 homolog B, crumbs cell polarity complex component |
| Reference | MIM:612331|HGNC:HGNC:17788|Ensembl:ENSG00000104863|HPRD:10040|Vega:OTTHUMG00000134288 |
| Gene type | protein-coding |
| Map location | 19q13.3 |
| Pascal p-value | 0.005 |
| Sherlock p-value | 0.619 |
| Fetal beta | -1.094 |
| eGene | Cortex Meta |
| Support | PROTEIN CLUSTERING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.1336 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 16192269 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007269 | neurotransmitter secretion | IEA | neuron, axon, Synap, serotonin, Neurotransmitter, dopamine (GO term level: 8) | - |
| GO:0006887 | exocytosis | IEA | - | |
| GO:0015031 | protein transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005923 | tight junction | IEA | Brain (GO term level: 10) | - |
| GO:0019717 | synaptosome | IEA | Synap, Brain (GO term level: 7) | - |
| GO:0045211 | postsynaptic membrane | IEA | Synap, Neurotransmitter (GO term level: 5) | - |
| GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0016323 | basolateral plasma membrane | IEA | - | |
| GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS G UP | 238 | 135 | All SZGR 2.0 genes in this pathway |
| LEE AGING CEREBELLUM DN | 86 | 66 | All SZGR 2.0 genes in this pathway |
| BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| MOLENAAR TARGETS OF CCND1 AND CDK4 UP | 67 | 48 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-200bc/429 | 41 | 47 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.