Gene Page: LIN7B

Summary
GeneID  64130
Symbol  LIN7B
Synonyms  LIN-7B|MALS-2|MALS2|VELI2
Description  lin-7 homolog B (C. elegans)
See related  HGNC:17788|MIM:612331|Ensembl:ENSG00000104863|HPRD:10040|
Locus tag  -
Gene type  protein-coding
Map location  19q13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 4 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.1336 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI16192269 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007269neurotransmitter secretionIEAneuron, axon, Synap, serotonin, Neurotransmitter, dopamine (GO term level: 8)-
GO:0006887exocytosisIEA-
GO:0015031protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005923tight junctionIEABrain (GO term level: 10)-
GO:0019717synaptosomeIEASynap, Brain (GO term level: 7)-
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0005886plasma membraneIEA-
GO:0016323basolateral plasma membraneIEA-
GO:0030054cell junctionIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACCN3ASIC3 | DRASIC | SLNAC1 | TNaC1amiloride-sensitive cation channel 3-HPRD,BioGRID15317815 
ASIC3 interacts with LIN-7B.BIND15317815 
APBA1D9S411E | MINT1 | X11 | X11A | X11ALPHAamyloid beta (A4) precursor protein-binding, family A, member 1-HPRD,BioGRID9753324 
BAIAP2BAP2 | IRSP53BAI1-associated protein 2-HPRD14596909 
CASKCAGH39 | CMG | FLJ22219 | FLJ31914 | LIN2 | MICPCH | TNRC8calcium/calmodulin-dependent serine protein kinase (MAGUK family)-HPRD11742811 
Affinity Capture-WesternBioGRID14960569 
DLG4FLJ97752 | FLJ98574 | PSD95 | SAP90discs, large homolog 4 (Drosophila)in vivoBioGRID10341223 
GRIN2BMGC142178 | MGC142180 | NMDAR2B | NR2B | hNR3glutamate receptor, ionotropic, N-methyl D-aspartate 2Bin vitro
in vivo
BioGRID10341223 
KCNJ12FLJ14167 | IRK2 | KCNJN1 | Kir2.2 | Kir2.2v | hIRK | hIRK1 | hkir2.2x | kcnj12xpotassium inwardly-rectifying channel, subfamily J, member 12Affinity Capture-Western
Reconstituted Complex
BioGRID14960569 |15024025 
KCNJ4HIR | HIRK2 | HRK1 | IRK3 | Kir2.3 | MGC142066 | MGC142068potassium inwardly-rectifying channel, subfamily J, member 4Affinity Capture-Western
Two-hybrid
BioGRID11742811 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-200bc/4294147m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.