Gene Page: WNK4
Summary ?
| GeneID | 65266 |
| Symbol | WNK4 |
| Synonyms | PHA2B|PRKWNK4 |
| Description | WNK lysine deficient protein kinase 4 |
| Reference | MIM:601844|HGNC:HGNC:14544|Ensembl:ENSG00000126562|HPRD:03505|Vega:OTTHUMG00000180650 |
| Gene type | protein-coding |
| Map location | 17q21.2 |
| Pascal p-value | 0.294 |
| Fetal beta | 0.083 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| WNK4 | chr17 | 40946661 | C | T | NM_032387 | . | silent | Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0005524 | ATP binding | ISS | - | |
| GO:0004674 | protein serine/threonine kinase activity | ISS | - | |
| GO:0016740 | transferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006468 | protein amino acid phosphorylation | ISS | - | |
| GO:0007243 | protein kinase cascade | ISS | - | |
| GO:0008104 | protein localization | IEA | - | |
| GO:0006821 | chloride transport | IEA | - | |
| GO:0006811 | ion transport | ISS | - | |
| GO:0050794 | regulation of cellular process | ISS | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005923 | tight junction | ISS | Brain (GO term level: 10) | - |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER ADVANCED VS EARLY DN | 138 | 70 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM2 | 153 | 102 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
| FINETTI BREAST CANCERS KINOME BLUE | 21 | 16 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
| SERVITJA ISLET HNF1A TARGETS DN | 109 | 71 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
| WANG MLL TARGETS | 289 | 188 | All SZGR 2.0 genes in this pathway |
| DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY LUMINAL MATURE UP | 116 | 65 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-137 | 263 | 269 | m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.