Gene Page: UGT8
Summary ?
| GeneID | 7368 |
| Symbol | UGT8 |
| Synonyms | CGT|UGT4 |
| Description | UDP glycosyltransferase 8 |
| Reference | MIM:601291|HGNC:HGNC:12555|Ensembl:ENSG00000174607|HPRD:03186|Vega:OTTHUMG00000132915 |
| Gene type | protein-coding |
| Map location | 4q26 |
| Pascal p-value | 0.608 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg00856157 | 4 | 115519920 | UGT8 | 3.45E-8 | -0.012 | 1.02E-5 | DMG:Jaffe_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7627622 | chr3 | 33850148 | UGT8 | 7368 | 0.1 | trans | ||
| rs6829546 | chr4 | 12587664 | UGT8 | 7368 | 0.06 | trans | ||
| rs6448932 | chr4 | 12595798 | UGT8 | 7368 | 0.01 | trans | ||
| rs7830259 | chr8 | 14087643 | UGT8 | 7368 | 0.06 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| COPS2 | 0.89 | 0.90 |
| ACTR6 | 0.89 | 0.89 |
| DCTN6 | 0.89 | 0.87 |
| PTGES3 | 0.88 | 0.86 |
| NCK1 | 0.87 | 0.85 |
| TCEAL8 | 0.87 | 0.86 |
| UBE2N | 0.87 | 0.83 |
| SUB1 | 0.86 | 0.83 |
| ZFAND6 | 0.86 | 0.83 |
| PSMD10 | 0.86 | 0.84 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.8 | -0.59 | -0.58 |
| MT-CO2 | -0.59 | -0.56 |
| AF347015.2 | -0.58 | -0.58 |
| AF347015.26 | -0.58 | -0.59 |
| MT-CYB | -0.58 | -0.58 |
| AF347015.33 | -0.57 | -0.57 |
| AF347015.15 | -0.57 | -0.58 |
| AF347015.18 | -0.54 | -0.57 |
| AF347015.27 | -0.54 | -0.55 |
| GPT | -0.53 | -0.57 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003851 | 2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity | IEA | - | |
| GO:0016758 | transferase activity, transferring hexosyl groups | IEA | - | |
| GO:0008489 | UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity | TAS | 8661025 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007417 | central nervous system development | TAS | Brain (GO term level: 6) | 8661025 |
| GO:0008152 | metabolic process | IEA | - | |
| GO:0007422 | peripheral nervous system development | TAS | 8661025 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG SPHINGOLIPID METABOLISM | 40 | 26 | All SZGR 2.0 genes in this pathway |
| SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
| DOANE BREAST CANCER ESR1 DN | 48 | 28 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS UP | 149 | 84 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 6 7WK DN | 79 | 54 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
| YANG BREAST CANCER ESR1 LASER DN | 50 | 38 | All SZGR 2.0 genes in this pathway |
| RICKMAN HEAD AND NECK CANCER B | 48 | 22 | All SZGR 2.0 genes in this pathway |
| BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
| GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
| WANG PROSTATE CANCER ANDROGEN INDEPENDENT | 66 | 37 | All SZGR 2.0 genes in this pathway |
| LANDEMAINE LUNG METASTASIS | 21 | 12 | All SZGR 2.0 genes in this pathway |
| LE EGR2 TARGETS DN | 108 | 84 | All SZGR 2.0 genes in this pathway |
| ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
| XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
| BANDRES RESPONSE TO CARMUSTIN MGMT 48HR UP | 18 | 13 | All SZGR 2.0 genes in this pathway |
| KRASNOSELSKAYA ILF3 TARGETS DN | 46 | 38 | All SZGR 2.0 genes in this pathway |
| BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
| LEIN OLIGODENDROCYTE MARKERS | 74 | 53 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
| TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
| ZHENG GLIOBLASTOMA PLASTICITY UP | 250 | 168 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER ESR1 DN | 240 | 153 | All SZGR 2.0 genes in this pathway |
| SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
| VERHAAK GLIOBLASTOMA NEURAL | 129 | 85 | All SZGR 2.0 genes in this pathway |
| TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| GOBERT CORE OLIGODENDROCYTE DIFFERENTIATION | 40 | 28 | All SZGR 2.0 genes in this pathway |
| ROESSLER LIVER CANCER METASTASIS DN | 53 | 29 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 238 | 244 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-218 | 161 | 168 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.