Gene Page: VGF
Summary ?
| GeneID | 7425 |
| Symbol | VGF |
| Synonyms | SCG7|SgVII |
| Description | VGF nerve growth factor inducible |
| Reference | MIM:602186|HGNC:HGNC:12684|Ensembl:ENSG00000128564|HPRD:03717|Vega:OTTHUMG00000157109 |
| Gene type | protein-coding |
| Map location | 7q22.1 |
| Pascal p-value | 0.044 |
| Fetal beta | -2.954 |
| eGene | Myers' cis & trans |
| Support | G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7597560 | chr2 | 202958513 | VGF | 7425 | 0.13 | trans | ||
| rs11235446 | chr11 | 71839397 | VGF | 7425 | 0.17 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| LIG3 | 0.95 | 0.96 |
| PAXIP1 | 0.95 | 0.95 |
| KDM3B | 0.95 | 0.95 |
| SIN3A | 0.95 | 0.96 |
| CYTSA | 0.94 | 0.96 |
| CHD4 | 0.94 | 0.93 |
| CRKRS | 0.94 | 0.95 |
| ZNF532 | 0.94 | 0.93 |
| CNOT6 | 0.94 | 0.96 |
| CTNND1 | 0.94 | 0.93 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.73 | -0.91 |
| AF347015.27 | -0.71 | -0.90 |
| MT-CO2 | -0.71 | -0.92 |
| FXYD1 | -0.70 | -0.89 |
| S100B | -0.70 | -0.84 |
| AF347015.33 | -0.70 | -0.87 |
| AIFM3 | -0.70 | -0.78 |
| C5orf53 | -0.69 | -0.76 |
| HLA-F | -0.69 | -0.77 |
| MT-CYB | -0.69 | -0.88 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005184 | neuropeptide hormone activity | IEA | axon, Synap, Brain, Neurotransmitter (GO term level: 6) | - |
| GO:0003674 | molecular_function | ND | - | |
| GO:0008083 | growth factor activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001541 | ovarian follicle development | IEA | - | |
| GO:0006091 | generation of precursor metabolites and energy | IEA | - | |
| GO:0019953 | sexual reproduction | IEA | - | |
| GO:0051591 | response to cAMP | IEP | 10381005 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0005615 | extracellular space | IDA | 15706611 | |
| GO:0031410 | cytoplasmic vesicle | IDA | 17440014 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS A DN | 90 | 61 | All SZGR 2.0 genes in this pathway |
| SILIGAN TARGETS OF EWS FLI1 FUSION UP | 15 | 12 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| MA PITUITARY FETAL VS ADULT UP | 29 | 21 | All SZGR 2.0 genes in this pathway |
| BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN | 161 | 105 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
| LIN NPAS4 TARGETS DN | 68 | 48 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
| SASAI TARGETS OF CXCR6 AND PTCH1 UP | 13 | 9 | All SZGR 2.0 genes in this pathway |
| HUNSBERGER EXERCISE REGULATED GENES | 31 | 26 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
| BHAT ESR1 TARGETS VIA AKT1 UP | 281 | 183 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-27 | 393 | 399 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-377 | 327 | 334 | 1A,m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.