Gene Page: CACNB2
Summary ?
GeneID | 783 |
Symbol | CACNB2 |
Synonyms | CACNLB2|CAVB2|MYSB |
Description | calcium voltage-gated channel auxiliary subunit beta 2 |
Reference | MIM:600003|HGNC:HGNC:1402|Ensembl:ENSG00000165995|HPRD:02473|Vega:OTTHUMG00000017764 |
Gene type | protein-coding |
Map location | 10p12 |
Pascal p-value | 1.42E-9 |
Sherlock p-value | 0.13 |
Fetal beta | -2.671 |
eGene | Myers' cis & trans |
Support | CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGC128 | Genome-wide Association Study | A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
CV:Ripke_2013 | Genome-wide Association Study | Multi-stage GWAS, Sweden population and PGC2. 24 leading SNPs | |
LK:YES | Genome-wide Association Study | This data set included 99 genes mapped to the 22 regions. The 24 leading SNPs were also included in CV:Ripke_2013 | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
CV:PGC128
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|---|---|---|---|---|---|---|
rs7893279 | chr10 | 18745105 | TG | 3.562E-11 | intronic | CACNB2 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6481737 | chr10 | 19360952 | CACNB2 | 783 | 0.13 | cis | ||
rs4509661 | chr10 | 19362931 | CACNB2 | 783 | 0.18 | cis | ||
rs4465279 | chr10 | 19363075 | CACNB2 | 783 | 0.16 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005509 | calcium ion binding | IEA | - | |
GO:0005244 | voltage-gated ion channel activity | IEA | - | |
GO:0005245 | voltage-gated calcium channel activity | IEA | - | |
GO:0005245 | voltage-gated calcium channel activity | TAS | 9254841 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007528 | neuromuscular junction development | TAS | Synap (GO term level: 10) | 8494331 |
GO:0006816 | calcium ion transport | IEA | - | |
GO:0006816 | calcium ion transport | NAS | - | |
GO:0006811 | ion transport | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | NAS | 9594024 | |
GO:0005891 | voltage-gated calcium channel complex | TAS | 9254841 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
KEGG CARDIAC MUSCLE CONTRACTION | 80 | 51 | All SZGR 2.0 genes in this pathway |
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM | 85 | 65 | All SZGR 2.0 genes in this pathway |
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC | 76 | 59 | All SZGR 2.0 genes in this pathway |
KEGG DILATED CARDIOMYOPATHY | 92 | 68 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
REACTOME INTEGRATION OF ENERGY METABOLISM | 120 | 84 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME NCAM1 INTERACTIONS | 39 | 27 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF INSULIN SECRETION | 93 | 65 | All SZGR 2.0 genes in this pathway |
REACTOME NCAM SIGNALING FOR NEURITE OUT GROWTH | 64 | 49 | All SZGR 2.0 genes in this pathway |
REACTOME INHIBITION OF INSULIN SECRETION BY ADRENALINE NORADRENALINE | 25 | 15 | All SZGR 2.0 genes in this pathway |
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN | 391 | 222 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE DN | 244 | 147 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA DN | 284 | 156 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
HADDAD T LYMPHOCYTE AND NK PROGENITOR UP | 78 | 56 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
CHEN LVAD SUPPORT OF FAILING HEART DN | 42 | 32 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY DN | 145 | 88 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION NEOCORTEX DN | 88 | 58 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER WITH H3K27ME3 UP | 295 | 149 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER WITH H3K9ME3 UP | 141 | 75 | All SZGR 2.0 genes in this pathway |
ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 1HR DN | 222 | 147 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 540 | 546 | m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
hsa-miR-101 | UACAGUACUGUGAUAACUGAAG | ||||
miR-124.1 | 490 | 496 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 490 | 496 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-128 | 1265 | 1271 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-145 | 1279 | 1285 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-151 | 729 | 735 | 1A | hsa-miR-151brain | ACUAGACUGAAGCUCCUUGAGG |
miR-181 | 814 | 820 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-182 | 1187 | 1193 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-199 | 958 | 964 | 1A | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC | ||||
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
miR-208 | 647 | 653 | 1A | hsa-miR-208 | AUAAGACGAGCAAAAAGCUUGU |
miR-26 | 1555 | 1561 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-27 | 1265 | 1271 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-30-5p | 1329 | 1336 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-31 | 487 | 493 | m8 | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
miR-339 | 684 | 690 | 1A | hsa-miR-339 | UCCCUGUCCUCCAGGAGCUCA |
miR-376c | 529 | 536 | 1A,m8 | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
miR-378 | 707 | 713 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-410 | 599 | 605 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-452 | 579 | 586 | 1A,m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
miR-499 | 646 | 653 | 1A,m8 | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
miR-543 | 568 | 574 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
miR-9 | 1510 | 1516 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
miR-96 | 1187 | 1193 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.