SZGR2

Summary ?

GeneID	80230
Symbol	RUFY1
Synonyms	RABIP4\|ZFYVE12
Description	RUN and FYVE domain containing 1
Reference	MIM:610327\|HGNC:HGNC:19760\|Ensembl:ENSG00000176783\|HPRD:15282\|Vega:OTTHUMG00000130913
Gene type	protein-coding
Map location	5q35.3
Pascal p-value	0.061
Sherlock p-value	0.656
Fetal beta	0.523
DMG	1 (# studies)
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.0276

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg21951679	5	178977648	RUFY1	5.308E-4	-0.209	0.048	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
GO:0008289	lipid binding	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0008565	protein transporter activity	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030100	regulation of endocytosis	IEA		-
GO:0015031	protein transport	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005737	cytoplasm	IEA		-
GO:0005768	endosome	IEA		-
GO:0016020	membrane	IEA		-
GO:0031901	early endosome membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
KIM GERMINAL CENTER T HELPER UP	66	42	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
LEE AGING NEOCORTEX UP	89	59	All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS UP	113	71	All SZGR 2.0 genes in this pathway
RAGHAVACHARI PLATELET SPECIFIC GENES	70	46	All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN	414	237	All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 1 DN	48	30	All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS DN	213	127	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124/506	385	391	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	385	391	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-182	16	22	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-96	15	22	1A,m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RUFY1