Gene Page: PRR3
Summary ?
| GeneID | 80742 |
| Symbol | PRR3 |
| Synonyms | CAT56 |
| Description | proline rich 3 |
| Reference | HGNC:HGNC:21149|HPRD:17915| |
| Gene type | protein-coding |
| Map location | 6p21.33 |
| Pascal p-value | 2.098E-14 |
| Sherlock p-value | 0.192 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.033 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg23654545 | 6 | 30525120 | PRR3;GNL1 | 3.853E-4 | -0.207 | 0.043 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| CUGBP1 | 0.86 | 0.87 |
| ZNF490 | 0.86 | 0.86 |
| NSD1 | 0.86 | 0.87 |
| CRKRS | 0.85 | 0.86 |
| DDX6 | 0.85 | 0.88 |
| TUG1 | 0.85 | 0.86 |
| USP24 | 0.85 | 0.85 |
| ZNF141 | 0.85 | 0.87 |
| N4BP1 | 0.85 | 0.87 |
| BIRC6 | 0.85 | 0.86 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MT-CO2 | -0.67 | -0.78 |
| AF347015.31 | -0.67 | -0.77 |
| AF347015.27 | -0.66 | -0.75 |
| MT-CYB | -0.65 | -0.75 |
| AF347015.8 | -0.64 | -0.76 |
| IFI27 | -0.64 | -0.74 |
| AF347015.21 | -0.64 | -0.81 |
| FXYD1 | -0.64 | -0.74 |
| AF347015.33 | -0.64 | -0.72 |
| HIGD1B | -0.64 | -0.75 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003676 | nucleic acid binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GRASEMANN RETINOBLASTOMA WITH 6P AMPLIFICATION | 14 | 14 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER MYC TARGETS AND SERUM RESPONSE UP | 47 | 32 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
| AMUNDSON GENOTOXIC SIGNATURE | 105 | 68 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
| PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS UP | 344 | 180 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
| YE METASTATIC LIVER CANCER | 27 | 13 | All SZGR 2.0 genes in this pathway |
| JAIN NFKB SIGNALING | 75 | 44 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 6HR DN | 160 | 101 | All SZGR 2.0 genes in this pathway |
| MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
| FUJII YBX1 TARGETS DN | 202 | 132 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| ROESSLER LIVER CANCER METASTASIS UP | 107 | 72 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124/506 | 5 | 11 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-182 | 698 | 704 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-224 | 668 | 674 | m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
| miR-27 | 1044 | 1050 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-29 | 306 | 312 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-324-3p | 1055 | 1061 | 1A | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
| miR-330 | 612 | 618 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
| miR-34b | 777 | 783 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
| miR-378 | 1097 | 1103 | m8 | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
| miR-96 | 698 | 704 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.