SZGR2

Summary ?

GeneID	8929
Symbol	PHOX2B
Synonyms	NBLST2\|NBPhox\|PMX2B
Description	paired like homeobox 2b
Reference	MIM:603851\|HGNC:HGNC:9143\|Ensembl:ENSG00000109132\|HPRD:09157\|Vega:OTTHUMG00000099379
Gene type	protein-coding
Map location	4p12
Pascal p-value	0.376
Fetal beta	0.195

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	1	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
FAM96B	0.92	0.91
EXOSC4	0.91	0.91
PSMB3	0.91	0.89
EXOSC5	0.91	0.90
C12orf10	0.90	0.89
NOSIP	0.90	0.88
SF3B5	0.90	0.88
PSMB4	0.89	0.88
ANAPC11	0.89	0.85
CUEDC2	0.89	0.88

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.26	-0.54	-0.57
AF347015.18	-0.50	-0.56
AF347015.8	-0.50	-0.50
AF347015.15	-0.50	-0.52
MT-ATP8	-0.49	-0.54
AF347015.2	-0.49	-0.51
MT-CYB	-0.48	-0.51
AF347015.27	-0.48	-0.52
AF347015.33	-0.48	-0.51
ANKRD18B	-0.45	-0.56

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	TAS		10395798
GO:0003712	transcription cofactor activity	TAS		10395798
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	TAS	neurite (GO term level: 5)	10395798
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0048468	cell development	IEA		-
GO:0007275	multicellular organismal development	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
LEE NEURAL CREST STEM CELL UP	146	99	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN DN	172	112	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN	203	134	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL RUNX1	9	6	All SZGR 2.0 genes in this pathway
XU GH1 EXOGENOUS TARGETS DN	120	69	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
MIKKELSEN PARTIALLY REPROGRAMMED TO PLURIPOTENCY	10	6	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS WITH HCP H3K27ME3	102	76	All SZGR 2.0 genes in this pathway
MIKKELSEN ES HCP WITH H3K27ME3	41	30	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS UP	163	111	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-125/351	323	329	m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	323	329	m8	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-138	1002	1008	m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-146	1444	1450	1A	hsa-miR-146a	UGAGAACUGAAUUCCAUGGGUU
miR-146	1444	1450	1A	hsa-miR-146b^brain	UGAGAACUGAAUUCCAUAGGCU
miR-181	1285	1291	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-320	1005	1011	m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-494	1584	1591	1A,m8	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-495	1505	1511	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-500	1514	1520	m8	hsa-miR-500	AUGCACCUGGGCAAGGAUUCUG
miR-543	1286	1292	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-7	997	1003	1A	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PHOX2B