SZGR2

Summary ?

GeneID	9266
Symbol	CYTH2
Synonyms	ARNO\|CTS18\|CTS18.1\|PSCD2\|PSCD2L\|SEC7L\|Sec7p-L\|Sec7p-like
Description	cytohesin 2
Reference	MIM:602488\|HGNC:HGNC:9502\|Ensembl:ENSG00000105443\|HPRD:03925\|Vega:OTTHUMG00000150245
Gene type	protein-coding
Map location	19q13.33
Pascal p-value	0.454
Sherlock p-value	0.848
Fetal beta	0.866
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0089

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg24083067	19	48972665	CYTH2	7.94E-5	-0.54	0.025	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
NPY1R	0.74	0.59
C1orf62	0.72	0.59
LMO4	0.72	0.55
TAL2	0.68	0.57
NPNT	0.66	0.52
RASGEF1C	0.65	0.66
RPRM	0.65	0.63
PTX3	0.64	0.57
STK32B	0.63	0.54
PPP1R14C	0.63	0.61

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
REEP6	-0.43	-0.42
TSC22D4	-0.39	-0.42
AIFM3	-0.39	-0.42
AF347015.27	-0.39	-0.49
HLA-F	-0.39	-0.39
RHBDL3	-0.39	-0.47
HEPN1	-0.38	-0.41
RENBP	-0.38	-0.43
CLU	-0.38	-0.39
AF347015.33	-0.38	-0.49

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005086	ARF guanyl-nucleotide exchange factor activity	IEA		-
GO:0005086	ARF guanyl-nucleotide exchange factor activity	TAS		9417041
GO:0005515	protein binding	IPI		14654833 \|16415858
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006897	endocytosis	TAS		9417041
GO:0030036	actin cytoskeleton organization	TAS		9417041
GO:0032012	regulation of ARF protein signal transduction	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005624	membrane fraction	TAS		9417041
GO:0005886	plasma membrane	TAS		9417041

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA ARAP PATHWAY	18	13	All SZGR 2.0 genes in this pathway
PID ARF6 PATHWAY	35	27	All SZGR 2.0 genes in this pathway
PID PI3KCI PATHWAY	49	40	All SZGR 2.0 genes in this pathway
PID ARF 3PATHWAY	19	13	All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN	493	298	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN	260	143	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN	329	219	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
ALCALA APOPTOSIS	88	60	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS	775	494	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
PETRETTO BLOOD PRESSURE DN	7	6	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
MURAKAMI UV RESPONSE 6HR UP	37	31	All SZGR 2.0 genes in this pathway
VERRECCHIA RESPONSE TO TGFB1 C2	25	18	All SZGR 2.0 genes in this pathway
VERRECCHIA EARLY RESPONSE TO TGFB1	58	43	All SZGR 2.0 genes in this pathway
BILD MYC ONCOGENIC SIGNATURE	206	117	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
MURAKAMI UV RESPONSE 1HR DN	10	8	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2	182	102	All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS DN	187	109	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
ZWANG DOWN BY 2ND EGF PULSE	293	119	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-28	114	120	m8	hsa-miR-28^brain	AAGGAGCUCACAGUCUAUUGAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CYTH2