Gene Page: TAOK2
Summary ?
| GeneID | 9344 |
| Symbol | TAOK2 |
| Synonyms | MAP3K17|PSK|PSK1|PSK1-BETA|TAO1|TAO2 |
| Description | TAO kinase 2 |
| Reference | MIM:613199|HGNC:HGNC:16835|Ensembl:ENSG00000149930|HPRD:18147|Vega:OTTHUMG00000132111 |
| Gene type | protein-coding |
| Map location | 16p11.2 |
| Pascal p-value | 8.333E-10 |
| Sherlock p-value | 0.755 |
| Fetal beta | -1.49 |
| DMG | 1 (# studies) |
| eGene | Meta |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS CompositeSet Darnell FMRP targets Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CNV:YES | Copy number variation studies | Manual curation | |
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Montano_2016 | Genome-wide DNA methylation analysis | This dataset includes 172 replicated associations between CpGs with schizophrenia. | 1 |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg16568360 | 16 | 29987261 | TAOK2 | 2.86E-4 | -0.005 | 0.177 | DMG:Montano_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0000287 | magnesium ion binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004674 | protein serine/threonine kinase activity | IDA | 10660600 | |
| GO:0004674 | protein serine/threonine kinase activity | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000186 | activation of MAPKK activity | IDA | 10660600 | |
| GO:0001558 | regulation of cell growth | NAS | 10660600 | |
| GO:0006468 | protein amino acid phosphorylation | IEA | - | |
| GO:0006950 | response to stress | IDA | 10660600 | |
| GO:0008360 | regulation of cell shape | IDA | 10660600 | |
| GO:0048041 | focal adhesion formation | IDA | 10660600 | |
| GO:0006915 | apoptosis | NAS | 10660600 | |
| GO:0006612 | protein targeting to membrane | NAS | 10660600 | |
| GO:0016477 | cell migration | NAS | 10660600 | |
| GO:0030036 | actin cytoskeleton organization | IDA | 10660600 | |
| GO:0046330 | positive regulation of JNK cascade | IDA | 10660600 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IDA | 18029348 | |
| GO:0005730 | nucleolus | IDA | 18029348 | |
| GO:0005737 | cytoplasm | IDA | 18029348 | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0030659 | cytoplasmic vesicle membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
| PID P38 MKK3 6PATHWAY | 26 | 21 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
| EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 2D UP | 69 | 46 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-143 | 132 | 139 | 1A,m8 | hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA |
| miR-151 | 316 | 322 | 1A | hsa-miR-151brain | ACUAGACUGAAGCUCCUUGAGG |
| miR-193 | 156 | 162 | m8 | hsa-miR-193a | AACUGGCCUACAAAGUCCCAG |
| hsa-miR-193b | AACUGGCCCUCAAAGUCCCGCUUU | ||||
| miR-204/211 | 569 | 575 | 1A | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
| hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.