Gene Page: ITM2B
Summary ?
| GeneID | 9445 |
| Symbol | ITM2B |
| Synonyms | ABRI|BRI|BRI2|BRICD2B|E25B|E3-16|FBD|RDGCA|imBRI2 |
| Description | integral membrane protein 2B |
| Reference | MIM:603904|HGNC:HGNC:6174|HPRD:04878| |
| Gene type | protein-coding |
| Map location | 13q14.3 |
| Pascal p-value | 0.02 |
| Sherlock p-value | 0.816 |
| Fetal beta | -1.92 |
| Support | CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| ITM2B | chr13 | 48830432 | T | TGAA | NM_021999 | . | codon-insertion | Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| STX5 | 0.93 | 0.92 |
| DHPS | 0.93 | 0.93 |
| ARMC6 | 0.92 | 0.92 |
| DCTN2 | 0.92 | 0.92 |
| PSMD3 | 0.92 | 0.92 |
| TINF2 | 0.92 | 0.91 |
| RPUSD4 | 0.91 | 0.92 |
| DEDD | 0.91 | 0.91 |
| ACTR1A | 0.91 | 0.91 |
| PRMT1 | 0.91 | 0.90 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.33 | -0.76 | -0.84 |
| AF347015.8 | -0.76 | -0.85 |
| MT-CO2 | -0.76 | -0.82 |
| MT-CYB | -0.75 | -0.83 |
| AF347015.27 | -0.75 | -0.83 |
| AF347015.31 | -0.75 | -0.81 |
| AF347015.26 | -0.74 | -0.86 |
| AF347015.15 | -0.74 | -0.83 |
| AF347015.2 | -0.72 | -0.81 |
| HEPN1 | -0.69 | -0.76 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 10391242 |
| GO:0006917 | induction of apoptosis | IEA | - | |
| GO:0007605 | sensory perception of sound | IEA | - | |
| GO:0006915 | apoptosis | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000139 | Golgi membrane | IEA | - | |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME AMYLOIDS | 83 | 63 | All SZGR 2.0 genes in this pathway |
| NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
| CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN | 391 | 222 | All SZGR 2.0 genes in this pathway |
| DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP | 177 | 110 | All SZGR 2.0 genes in this pathway |
| WANG CLIM2 TARGETS DN | 186 | 114 | All SZGR 2.0 genes in this pathway |
| PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
| LUI THYROID CANCER PAX8 PPARG DN | 45 | 29 | All SZGR 2.0 genes in this pathway |
| LUI THYROID CANCER CLUSTER 3 | 28 | 16 | All SZGR 2.0 genes in this pathway |
| LUI TARGETS OF PAX8 PPARG FUSION | 34 | 23 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
| JOHANSSON BRAIN CANCER EARLY VS LATE DN | 45 | 35 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
| GNATENKO PLATELET SIGNATURE | 48 | 28 | All SZGR 2.0 genes in this pathway |
| SHEPARD BMYB MORPHOLINO UP | 205 | 126 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| PARK HSC AND MULTIPOTENT PROGENITORS | 50 | 33 | All SZGR 2.0 genes in this pathway |
| LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
| XU RESPONSE TO TRETINOIN UP | 16 | 10 | All SZGR 2.0 genes in this pathway |
| IGLESIAS E2F TARGETS UP | 151 | 103 | All SZGR 2.0 genes in this pathway |
| KAAB FAILED HEART ATRIUM DN | 141 | 99 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RESPONSE TO TRABECTEDIN UP | 71 | 49 | All SZGR 2.0 genes in this pathway |
| SCHLINGEMANN SKIN CARCINOGENESIS TPA DN | 29 | 15 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV SCC UP | 123 | 75 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER T7 | 98 | 63 | All SZGR 2.0 genes in this pathway |
| ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER POOR SURVIVAL UP | 31 | 22 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
| BOCHKIS FOXA2 TARGETS | 425 | 261 | All SZGR 2.0 genes in this pathway |
| RAY TUMORIGENESIS BY ERBB2 CDC25A DN | 159 | 105 | All SZGR 2.0 genes in this pathway |
| WANG TUMOR INVASIVENESS DN | 210 | 128 | All SZGR 2.0 genes in this pathway |
| HELLEBREKERS SILENCED DURING TUMOR ANGIOGENESIS | 80 | 56 | All SZGR 2.0 genes in this pathway |
| GOLDRATH ANTIGEN RESPONSE | 346 | 192 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
| DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
| KYNG RESPONSE TO H2O2 VIA ERCC6 DN | 46 | 31 | All SZGR 2.0 genes in this pathway |
| KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
| KASLER HDAC7 TARGETS 1 DN | 17 | 13 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
| SMIRNOV RESPONSE TO IR 6HR UP | 166 | 97 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-143 | 128 | 135 | 1A,m8 | hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA |
| miR-224 | 372 | 379 | 1A,m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
| miR-324-3p | 67 | 73 | 1A | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
| miR-452 | 105 | 111 | 1A | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
| miR-496 | 95 | 101 | m8 | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-9 | 680 | 687 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.