Gene Page: RAPGEF5
Summary ?
| GeneID | 9771 |
| Symbol | RAPGEF5 |
| Synonyms | GFR|MR-GEF|REPAC |
| Description | Rap guanine nucleotide exchange factor 5 |
| Reference | MIM:609527|HGNC:HGNC:16862|Ensembl:ENSG00000136237|HPRD:15208|Vega:OTTHUMG00000152525 |
| Gene type | protein-coding |
| Map location | 7p15.3 |
| Pascal p-value | 0.035 |
| Sherlock p-value | 0.694 |
| Support | Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| BTBD9 | 0.88 | 0.89 |
| TRAPPC10 | 0.86 | 0.86 |
| ABR | 0.86 | 0.87 |
| ATXN1L | 0.86 | 0.86 |
| SYT11 | 0.86 | 0.86 |
| RGL1 | 0.86 | 0.86 |
| HIPK1 | 0.85 | 0.87 |
| RAPGEF2 | 0.85 | 0.86 |
| LRP11 | 0.85 | 0.84 |
| MTMR12 | 0.85 | 0.86 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.21 | -0.57 | -0.48 |
| C1orf54 | -0.55 | -0.54 |
| GNG11 | -0.54 | -0.49 |
| IL32 | -0.53 | -0.51 |
| SYCP3 | -0.53 | -0.53 |
| AL050337.1 | -0.51 | -0.49 |
| C1orf61 | -0.50 | -0.52 |
| AC098691.2 | -0.50 | -0.48 |
| APOC1 | -0.49 | -0.42 |
| VAMP5 | -0.49 | -0.38 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005085 | guanyl-nucleotide exchange factor activity | IEA | - | |
| GO:0017034 | Rap guanyl-nucleotide exchange factor activity | IDA | 10486569 | |
| GO:0030742 | GTP-dependent protein binding | IPI | 10934204 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007399 | nervous system development | NAS | neurite (GO term level: 5) | 10486569 |
| GO:0007264 | small GTPase mediated signal transduction | IEA | - | |
| GO:0051056 | regulation of small GTPase mediated signal transduction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | IDA | 10486569 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| SCHUETZ BREAST CANCER DUCTAL INVASIVE DN | 84 | 53 | All SZGR 2.0 genes in this pathway |
| HORIUCHI WTAP TARGETS UP | 306 | 188 | All SZGR 2.0 genes in this pathway |
| GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS GREY DN | 74 | 44 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D DN | 31 | 19 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
| PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
| KIM MYC AMPLIFICATION TARGETS UP | 201 | 127 | All SZGR 2.0 genes in this pathway |
| KOYAMA SEMA3B TARGETS UP | 292 | 168 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
| TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
| BASSO CD40 SIGNALING DN | 68 | 44 | All SZGR 2.0 genes in this pathway |
| PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP | 131 | 87 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA CD1 VS CD2 DN | 52 | 35 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER P3 | 160 | 103 | All SZGR 2.0 genes in this pathway |
| BOQUEST STEM CELL DN | 216 | 143 | All SZGR 2.0 genes in this pathway |
| JIANG TIP30 TARGETS UP | 46 | 28 | All SZGR 2.0 genes in this pathway |
| LEE EARLY T LYMPHOCYTE UP | 107 | 59 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| PEDERSEN METASTASIS BY ERBB2 ISOFORM 4 | 110 | 66 | All SZGR 2.0 genes in this pathway |
| YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
| ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 3554 | 3560 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-125/351 | 3790 | 3797 | 1A,m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
| miR-137 | 3997 | 4004 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
| hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG | ||||
| miR-144 | 3554 | 3560 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-182 | 3527 | 3534 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-196 | 3779 | 3785 | 1A | hsa-miR-196a | UAGGUAGUUUCAUGUUGUUGG |
| hsa-miR-196b | UAGGUAGUUUCCUGUUGUUGG | ||||
| miR-218 | 1871 | 1877 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-219 | 621 | 627 | 1A | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
| miR-378 | 149 | 155 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
| miR-496 | 3983 | 3989 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-96 | 3528 | 3534 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.