Gene Page: CYP46A1
Summary ?
GeneID | 10858 |
Symbol | CYP46A1 |
Synonyms | CP46|CYP46 |
Description | cytochrome P450 family 46 subfamily A member 1 |
Reference | MIM:604087|HGNC:HGNC:2641|Ensembl:ENSG00000036530|HPRD:04970|Vega:OTTHUMG00000171510 |
Gene type | protein-coding |
Map location | 14q32.1 |
Pascal p-value | 0.545 |
Sherlock p-value | 0.287 |
Fetal beta | -1.65 |
eGene | Cerebellar Hemisphere Cerebellum |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SP1 | 0.87 | 0.88 |
CTDSP2 | 0.85 | 0.84 |
EIF2C1 | 0.84 | 0.86 |
SS18 | 0.84 | 0.84 |
EIF2C3 | 0.83 | 0.83 |
CRTC3 | 0.83 | 0.84 |
ARNT | 0.82 | 0.82 |
GPATCH8 | 0.82 | 0.83 |
H6PD | 0.81 | 0.79 |
NUP98 | 0.81 | 0.80 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.60 | -0.67 |
AF347015.31 | -0.56 | -0.60 |
MT-CO2 | -0.56 | -0.60 |
IL32 | -0.55 | -0.66 |
IFI27 | -0.55 | -0.58 |
C1orf54 | -0.54 | -0.64 |
HIGD1B | -0.53 | -0.57 |
CXCL14 | -0.52 | -0.57 |
AF347015.8 | -0.51 | -0.55 |
AF347015.27 | -0.50 | -0.56 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005506 | iron ion binding | IEA | - | |
GO:0004497 | monooxygenase activity | IEA | - | |
GO:0020037 | heme binding | IEA | - | |
GO:0008395 | steroid hydroxylase activity | TAS | 10377398 | |
GO:0009055 | electron carrier activity | IEA | - | |
GO:0033781 | cholesterol 24-hydroxylase activity | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 10377398 |
GO:0008202 | steroid metabolic process | IEA | - | |
GO:0006707 | cholesterol catabolic process | TAS | 10377398 | |
GO:0006629 | lipid metabolic process | IEA | - | |
GO:0055114 | oxidation reduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005792 | microsome | IEA | - | |
GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
GO:0005783 | endoplasmic reticulum | TAS | 10377398 | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PRIMARY BILE ACID BIOSYNTHESIS | 16 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME BILE ACID AND BILE SALT METABOLISM | 27 | 11 | All SZGR 2.0 genes in this pathway |
REACTOME SYNTHESIS OF BILE ACIDS AND BILE SALTS VIA 24 HYDROXYCHOLESTEROL | 10 | 6 | All SZGR 2.0 genes in this pathway |
REACTOME SYNTHESIS OF BILE ACIDS AND BILE SALTS | 19 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME BIOLOGICAL OXIDATIONS | 139 | 91 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOCHROME P450 ARRANGED BY SUBSTRATE TYPE | 51 | 34 | All SZGR 2.0 genes in this pathway |
REACTOME PHASE1 FUNCTIONALIZATION OF COMPOUNDS | 70 | 50 | All SZGR 2.0 genes in this pathway |
REACTOME ENDOGENOUS STEROLS | 15 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM4 | 261 | 153 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 397 | 403 | m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-505 | 563 | 569 | m8 | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.