Gene Page: CNTN1
Summary ?
| GeneID | 1272 |
| Symbol | CNTN1 |
| Synonyms | F3|GP135|MYPCN |
| Description | contactin 1 |
| Reference | MIM:600016|HGNC:HGNC:2171|Ensembl:ENSG00000018236|HPRD:07189|Vega:OTTHUMG00000169362 |
| Gene type | protein-coding |
| Map location | 12q12 |
| Pascal p-value | 0.005 |
| Sherlock p-value | 0.083 |
| eGene | Cerebellar Hemisphere Cerebellum Myers' cis & trans |
| Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0389 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs17788483 | chr20 | 49379810 | CNTN1 | 1272 | 0.1 | trans | ||
| snp_a-1999063 | 0 | CNTN1 | 1272 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| COL1A1 | 0.92 | 0.81 |
| COL1A2 | 0.91 | 0.82 |
| LUM | 0.90 | 0.64 |
| COL6A3 | 0.88 | 0.57 |
| OLFML3 | 0.86 | 0.65 |
| BMP5 | 0.86 | 0.57 |
| ITIH2 | 0.85 | 0.43 |
| SLC6A4 | 0.85 | 0.47 |
| PCOLCE | 0.85 | 0.69 |
| OGN | 0.83 | 0.44 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| LHPP | -0.29 | -0.37 |
| HLA-F | -0.28 | -0.40 |
| RGN | -0.28 | -0.43 |
| SEPT4 | -0.28 | -0.58 |
| AC018755.7 | -0.28 | -0.44 |
| FBXO2 | -0.28 | -0.38 |
| AF347015.33 | -0.28 | -0.46 |
| ALDOC | -0.28 | -0.39 |
| HEPN1 | -0.28 | -0.40 |
| S100A1 | -0.27 | -0.51 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007155 | cell adhesion | NAS | 7959734 | |
| GO:0007219 | Notch signaling pathway | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005624 | membrane fraction | TAS | 7959734 | |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0031225 | anchored to membrane | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ANK3 | ANKYRIN-G | FLJ45464 | ankyrin 3, node of Ranvier (ankyrin G) | Affinity Capture-Western | BioGRID | 14761957 |
| CNTN2 | AXT | DKFZp781D102 | FLJ42746 | MGC157722 | TAG-1 | TAX | TAX1 | contactin 2 (axonal) | - | HPRD,BioGRID | 12139915 |
| FYN | MGC45350 | SLK | SYN | FYN oncogene related to SRC, FGR, YES | - | HPRD,BioGRID | 7595520 |
| L1CAM | CAML1 | CD171 | HSAS | HSAS1 | MASA | MIC5 | N-CAML1 | S10 | SPG1 | L1 cell adhesion molecule | - | HPRD,BioGRID | 7595520 |
| NOTCH1 | TAN1 | hN1 | Notch homolog 1, translocation-associated (Drosophila) | - | HPRD,BioGRID | 14567914 |
| NOTCH2 | AGS2 | hN2 | Notch homolog 2 (Drosophila) | - | HPRD,BioGRID | 14567914 |
| PRNP | ASCR | CD230 | CJD | GSS | MGC26679 | PRIP | PrP | PrP27-30 | PrP33-35C | PrPc | prion | prion protein | - | HPRD | 15146195 |
| PTPRB | DKFZp686E2262 | DKFZp686H15164 | FLJ44133 | HPTP-BETA | HPTPB | MGC142023 | MGC59935 | PTPB | R-PTP-BETA | VEPTP | protein tyrosine phosphatase, receptor type, B | - | HPRD,BioGRID | 7628014 |9049255 |9584610 |12700241 |
| PTPRZ1 | HPTPZ | HPTPzeta | PTP-ZETA | PTP18 | PTPRZ | PTPZ | RPTPB | RPTPbeta | phosphacan | protein tyrosine phosphatase, receptor-type, Z polypeptide 1 | Affinity Capture-Western | BioGRID | 12700241 |
| SCN1B | GEFSP1 | sodium channel, voltage-gated, type I, beta | Affinity Capture-Western | BioGRID | 14761957 |
| SCNN1B | ENaCb | ENaCbeta | SCNEB | sodium channel, nonvoltage-gated 1, beta | - | HPRD | 11567041 |14761957 |
| TNC | HXB | MGC167029 | TN | tenascin C | - | HPRD | 10103110 |
| TNR | MGC149328 | TN-R | tenascin R (restrictin, janusin) | - | HPRD | 9081628 |9335257 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CELL ADHESION MOLECULES CAMS | 134 | 93 | All SZGR 2.0 genes in this pathway |
| PID NOTCH PATHWAY | 59 | 49 | All SZGR 2.0 genes in this pathway |
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME ACTIVATED NOTCH1 TRANSMITS SIGNAL TO THE NUCLEUS | 27 | 18 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH1 | 70 | 46 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME L1CAM INTERACTIONS | 86 | 62 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH | 103 | 64 | All SZGR 2.0 genes in this pathway |
| PARENT MTOR SIGNALING DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
| CHEBOTAEV GR TARGETS DN | 120 | 73 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 4 5WK UP | 271 | 175 | All SZGR 2.0 genes in this pathway |
| KIM MYC AMPLIFICATION TARGETS UP | 201 | 127 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
| RICKMAN HEAD AND NECK CANCER C | 113 | 47 | All SZGR 2.0 genes in this pathway |
| JI METASTASIS REPRESSED BY STK11 | 27 | 17 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
| NGUYEN NOTCH1 TARGETS UP | 29 | 23 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
| MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
| MCCABE HOXC6 TARGETS DN | 21 | 15 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA PR DN | 44 | 34 | All SZGR 2.0 genes in this pathway |
| WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
| VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 233 | 239 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 233 | 239 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-299-5p | 240 | 246 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-421 | 156 | 162 | 1A | hsa-miR-421 | GGCCUCAUUAAAUGUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.