SZGR2

Summary ?

GeneID	136319
Symbol	MTPN
Synonyms	GCDP\|V-1
Description	myotrophin
Reference	MIM:606484\|HGNC:HGNC:15667\|Ensembl:ENSG00000105887\|HPRD:07574\|Vega:OTTHUMG00000155627
Gene type	protein-coding
Map location	7q33
Sherlock p-value	9.733E-5
Fetal beta	-0.386
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs1570589	chr9	116874354	MTPN	136319		0.1		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	NAS		12031792
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030182	neuron differentiation	NAS	neuron (GO term level: 8)	12031792
GO:0006417	regulation of translation	NAS		12031792
GO:0016049	cell growth	NAS		12031792
GO:0016202	regulation of striated muscle development	NAS		12031792
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005575	cellular_component	ND		-
GO:0005622	intracellular	IDA		11256614
GO:0005737	cytoplasm	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
RASHI RESPONSE TO IONIZING RADIATION 4	61	34	All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN	165	104	All SZGR 2.0 genes in this pathway
NOUZOVA TRETINOIN AND H4 ACETYLATION	143	85	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR UP	174	96	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP	973	570	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS UP	74	45	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP	518	299	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE M G1	148	95	All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN	414	237	All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS	289	187	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN	315	215	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	1410	1416	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-1/206	720	726	1A	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-124.1	460	467	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	460	466	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	460	466	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-135	828	834	1A	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	828	834	1A	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-136	2948	2955	1A,m8	hsa-miR-136	ACUCCAUUUGUUUUGAUGAUGGA
miR-137	439	445	m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-137	439	445	m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-141/200a	2893	2899	m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	2893	2899	m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-143	2439	2445	1A	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-144	3107	3113	m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-181	1404	1411	1A,m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-186	944	950	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-217	2132	2139	1A,m8	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-219	1719	1725	1A	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-223	666	672	m8	hsa-miR-223	UGUCAGUUUGUCAAAUACCCC
miR-26	3150	3156	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	3150	3156	1A	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-330	2996	3002	m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-338	601	607	1A	hsa-miR-338^brain	UCCAGCAUCAGUGAUUUUGUUGA
miR-375	3135	3141	1A	hsa-miR-375	UUUGUUCGUUCGGCUCGCGUGA
miR-381	2829	2835	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-410	762	768	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-493-5p	3085	3091	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-539	3063	3069	1A	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU
miR-542-3p	67	73	m8	hsa-miR-542-3p	UGUGACAGAUUGAUAACUGAAA
miR-9	996	1002	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MTPN