SZGR2

Summary ?

GeneID	1657
Symbol	DMXL1
Synonyms	-
Description	Dmx like 1
Reference	MIM:605671\|HGNC:HGNC:2937\|Ensembl:ENSG00000172869\|HPRD:09294\|Vega:OTTHUMG00000128898
Gene type	protein-coding
Map location	5q22
Pascal p-value	0.867
Fetal beta	-0.419
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg04856203	5	118407258	DMXL1	8.43E-8	-0.007	1.95E-5	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs4911977	chr1	19239514	DMXL1	1657	0.16	trans
rs823066	chr1	205771172	DMXL1	1657	0.02	trans
rs9882137	chr3	29494146	DMXL1	1657	0.03	trans
rs4491879	chr3	189373908	DMXL1	1657	0.1	trans
rs4505678	chr3	189374356	DMXL1	1657	0.08	trans
snp_a-2169623		0	DMXL1	1657	0.14	trans
rs16894557	chr6	28999825	DMXL1	1657	0.14	trans
rs17139868	chr7	117079228	DMXL1	1657	0.07	trans
rs917836	chr18	20053367	DMXL1	1657	0.18	trans
rs12327665	chr19	39622639	DMXL1	1657	0.05	trans
rs6040607	chr20	11371092	DMXL1	1657	0.19	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004252	serine-type endopeptidase activity	IEA	glutamate (GO term level: 7)	-
GO:0005515	protein binding	TAS		10708522
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006508	proteolysis	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN	384	230	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 DN	281	186	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN	546	351	All SZGR 2.0 genes in this pathway
PARK HSC MARKERS	44	31	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO SERM OR FULVESTRANT UP	24	14	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP	518	299	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN	150	99	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP	397	206	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 1 DN	63	39	All SZGR 2.0 genes in this pathway
TERAO AOX4 TARGETS SKIN DN	27	15	All SZGR 2.0 genes in this pathway
RATTENBACHER BOUND BY CELF1	467	251	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM A	182	108	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	148	155	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	148	154	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	148	154	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-141/200a	993	999	m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	993	999	m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-148/152	140	147	1A,m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-182	1110	1117	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-205	1421	1427	m8	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-219	1890	1896	1A	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-23	1010	1017	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	1010	1017	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-25/32/92/363/367	1601	1608	1A,m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-26	1247	1253	m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	1247	1253	m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-323	1010	1016	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-96	1111	1117	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DMXL1