SZGR2

Summary ?

GeneID	203447
Symbol	NRK
Synonyms	NESK
Description	Nik related kinase
Reference	MIM:300791\|HGNC:HGNC:25391\|Ensembl:ENSG00000123572\|HPRD:14841\|Vega:OTTHUMG00000022143
Gene type	protein-coding
Map location	Xq22.3

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Expression	Meta-analysis of gene expression	P value: 1.79
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003700	transcription factor activity	IEA		-
GO:0005083	small GTPase regulator activity	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0004674	protein serine/threonine kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0007256	activation of JNKK activity	IEA		-
GO:0045449	regulation of transcription	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID TNF PATHWAY	46	33	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK DN	196	131	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM5	94	59	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA RADIATION	81	59	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP	226	164	All SZGR 2.0 genes in this pathway
FINETTI BREAST CANCERS KINOME BLUE	21	16	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
LABBE WNT3A TARGETS DN	97	53	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3 UNMETHYLATED	37	21	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP	504	321	All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS UP	169	105	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	1325	1331	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-101	776	783	1A,m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-128	247	253	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
				hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
				hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
				hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-136	1798	1804	m8	hsa-miR-136	ACUCCAUUUGUUUUGAUGAUGGA
miR-139	778	785	1A,m8	hsa-miR-139^brain	UCUACAGUGCACGUGUCU
miR-144	777	783	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-19	221	228	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	221	228	1A,m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-196	1396	1402	m8	hsa-miR-196a	UAGGUAGUUUCAUGUUGUUGG
miR-196	1396	1402	m8	hsa-miR-196b	UAGGUAGUUUCCUGUUGUUGG
miR-221/222	129	136	1A,m8	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	129	136	1A,m8	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-23	1609	1615	m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	1609	1615	m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-27	1596	1602	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
				hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
				hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
				hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-30-5p	1640	1647	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-320	160	167	1A,m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-323	1608	1615	1A,m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-377	1433	1439	m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-486	751	757	1A	hsa-miR-486	UCCUGUACUGAGCUGCCCCGAG
miR-493-5p	209	215	1A	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-495	241	247	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NRK