SZGR2

Summary ?

GeneID	2099
Symbol	ESR1
Synonyms	ER\|ESR\|ESRA\|ESTRR\|Era\|NR3A1
Description	estrogen receptor 1
Reference	MIM:133430\|HGNC:HGNC:3467\|Ensembl:ENSG00000091831\|HPRD:00589\|Vega:OTTHUMG00000016103
Gene type	protein-coding
Map location	6q25.1
Pascal p-value	0.85
Fetal beta	-0.912
DMG	1 (# studies)
eGene	Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Expression	Meta-analysis of gene expression	P value: 2.351
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.4727

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg18007957	6	152011666	ESR1	5.682E-4	0.422	0.049	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs443832	chr16	83779643	ESR1	2099		0.16		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CAMKK1	0.93	0.78
SYT12	0.93	0.86
EHD3	0.92	0.91
MAST3	0.92	0.87
SLC12A5	0.92	0.86
CNTNAP1	0.91	0.87
SIRPA	0.91	0.90
IQSEC1	0.91	0.85
PHF15	0.91	0.82
MAP1A	0.90	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
BCL7C	-0.54	-0.65
C9orf46	-0.53	-0.63
GTF3C6	-0.52	-0.57
EXOSC8	-0.51	-0.59
FAM36A	-0.50	-0.50
DYNLT1	-0.49	-0.67
AC006276.2	-0.49	-0.50
RBMX2	-0.48	-0.62
RPS8	-0.48	-0.65
RPL36	-0.48	-0.64

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	IEA		-
GO:0003677	DNA binding	IEA		-
GO:0003700	transcription factor activity	IEA		-
GO:0003707	steroid hormone receptor activity	IEA		-
GO:0003707	steroid hormone receptor activity	NAS		11004670
GO:0030235	nitric-oxide synthase regulator activity	NAS		12389206
GO:0005496	steroid binding	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0030284	estrogen receptor activity	NAS		3753802
GO:0046872	metal ion binding	IEA		-
GO:0047485	protein N-terminus binding	IPI		12917342
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	NAS		3753802
GO:0030520	estrogen receptor signaling pathway	NAS		3753802
GO:0006350	transcription	IEA		-
GO:0007165	signal transduction	TAS		10749889 \|10970861
GO:0048386	positive regulation of retinoic acid receptor signaling pathway	IDA		15831516
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005634	nucleus	NAS		-
GO:0005730	nucleolus	IDA		18029348
GO:0005737	cytoplasm	IDA		18029348
GO:0005886	plasma membrane	IDA		18029348
GO:0016585	chromatin remodeling complex	NAS		12351687

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
			ER interacts with LOC441967.	BIND	16009131
AHR	-	aryl hydrocarbon receptor	-	HPRD,BioGRID	10620335 \|12612060
AKAP13	AKAP-Lbc \| BRX \| FLJ11952 \| FLJ43341 \| HA-3 \| Ht31 \| LBC \| PROTO-LB \| PROTO-LBC \| c-lbc	A kinase (PRKA) anchor protein 13	-	HPRD,BioGRID	9627117
ANP32A	C15orf1 \| I1PP2A \| LANP \| MAPM \| MGC119787 \| MGC150373 \| PHAP1 \| PHAPI \| PP32	acidic (leucine-rich) nuclear phosphoprotein 32 family, member A	ER-alpha interacts with pp32.	BIND	15308690
AP1B1	ADTB1 \| AP105A \| BAM22 \| CLAPB2	adaptor-related protein complex 1, beta 1 subunit	ER interacts with AP1B1.	BIND	16009131
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	-	HPRD,BioGRID	12389206
ASCC2	ASC1p100	activating signal cointegrator 1 complex subunit 2	ER interacts with ASC1p100.	BIND	16009131
AXIN2	AXIL \| DKFZp781B0869 \| MGC10366 \| MGC126582	axin 2	ER-alpha interacts with the Axin2 promoter.	BIND	15304487
BAG1	RAP46	BCL2-associated athanogene	-	HPRD,BioGRID	8524784
BAGE3	-	B melanoma antigen family, member 3	ER interacts with BAGE3.	BIND	16009131
BAZ1B	WBSCR10 \| WBSCR9 \| WSTF	bromodomain adjacent to zinc finger domain, 1B	Affinity Capture-Western	BioGRID	12837248
BCAS2	DAM1	breast carcinoma amplified sequence 2	BCAS2 interacts with ER-alpha. This interaction was modeled on a demonstrated interaction between human BCAS2 and ER-alpha from an unspecified species.	BIND	15694360
BDNF	MGC34632	brain-derived neurotrophic factor	-	HPRD	11923430
BLOC1S1	BLOS1 \| FLJ39337 \| FLJ97089 \| GCN5L1 \| MGC87455 \| MICoA \| RT14	biogenesis of lysosomal organelles complex-1, subunit 1	ER interacts with MICoA	BIND	12639951
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	-	HPRD	10334989
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	Affinity Capture-Western Co-localization Reconstituted Complex	BioGRID	11244506 \|11493692 \|11782371 \|12400015
C21orf129	FLJ32835 \| PRED76	chromosome 21 open reading frame 129	ER interacts with C21orf129.	BIND	16009131
CALM1	CALML2 \| CAMI \| DD132 \| PHKD	calmodulin 1 (phosphorylase kinase, delta)	-	HPRD	11981030
CALM2	CAMII \| PHKD \| PHKD2	calmodulin 2 (phosphorylase kinase, delta)	-	HPRD	11981030
CALM3	PHKD \| PHKD3	calmodulin 3 (phosphorylase kinase, delta)	-	HPRD	11981030
CAV1	CAV \| MSTP085 \| VIP21	caveolin 1, caveolae protein, 22kDa	-	HPRD,BioGRID	11563984
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	-	HPRD,BioGRID	9039267
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	ER-alpha interacts with cyclin D1 promoter.	BIND	15808510
CCNH	CAK \| p34 \| p37	cyclin H	Affinity Capture-Western	BioGRID	12527756
CDC25B	-	cell division cycle 25 homolog B (S. pombe)	-	HPRD,BioGRID	11689696
CDK7	CAK1 \| CDKN7 \| MO15 \| STK1 \| p39MO15	cyclin-dependent kinase 7	Biochemical Activity	BioGRID	10949034
CEBPA	C/EBP-alpha \| CEBP	CCAAT/enhancer binding protein (C/EBP), alpha	Reconstituted Complex	BioGRID	9817600
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	-	HPRD,BioGRID	7651415
CELSR1	CDHF9 \| DKFZp434P0729 \| FMI2 \| HFMI2 \| ME2	cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila)	ER interacts with CELSR1.	BIND	16009131
CHUK	IKBKA \| IKK-alpha \| IKK1 \| IKKA \| NFKBIKA \| TCF16	conserved helix-loop-helix ubiquitous kinase	IKK-alpha interacts with ER-alpha.	BIND	15808510
COBRA1	DKFZp586B0519 \| KIAA1182 \| NELF-B \| NELFB	cofactor of BRCA1	-	HPRD,BioGRID	15342491
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	Affinity Capture-Western Reconstituted Complex	BioGRID	11113179 \|11782371
CSNK1E	HCKIE \| MGC10398	casein kinase 1, epsilon	ER interacts with CSNK1E.	BIND	16009131
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	Affinity Capture-Western	BioGRID	15304487
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	beta-catenin interacts with ER-alpha.	BIND	15304487
CYB5R3	B5R \| DIA1	cytochrome b5 reductase 3	ER interacts with CYB5R3.	BIND	16009131
DAP3	DAP-3 \| DKFZp686G12159 \| MGC126058 \| MGC126059 \| MRP-S29 \| MRPS29 \| bMRP-10	death associated protein 3	Reconstituted Complex	BioGRID	10903152
DDX17	DKFZp761H2016 \| P72 \| RH70	DEAD (Asp-Glu-Ala-Asp) box polypeptide 17	ESR1 (ER-alpha) interacts with an unspecified isoform of DDX17 (p72). This interaction was modeled on a demonstrated interaction between ESR1 from an unspecified species and DDX17 from an unspecified species.	BIND	12738788
DDX5	DKFZp686J01190 \| G17P1 \| HLR1 \| HUMP68 \| p68	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5	Affinity Capture-Western Two-hybrid	BioGRID	10409727
DDX5	DKFZp686J01190 \| G17P1 \| HLR1 \| HUMP68 \| p68	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5	ESR1 (ER-alpha) interacts with DDX5 (p68). This interaction was modeled on a demonstrated interaction between ESR1 from an unspecified species and DDX5 from an unspecified species.	BIND	12738788
DDX54	DP97 \| MGC2835	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	-	HPRD,BioGRID	12466272
DNTTIP2	ERBP \| FCF2 \| HSU15552 \| LPTS-RP2 \| MGC163494 \| RP4-561L24.1 \| TdIF2	deoxynucleotidyltransferase, terminal, interacting protein 2	-	HPRD,BioGRID	15047147
DSCAM	CHD2-42 \| CHD2-52	Down syndrome cell adhesion molecule	ER interacts with DSCAM-1 enhancer.	BIND	16009131
EBAG9	EB9 \| PDAF \| RCAS1	estrogen receptor binding site associated, antigen, 9	ER-alpha interacts with EBAG9 promoter.	BIND	15808510
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	-	HPRD,BioGRID	11887937
EIF3I	EIF3S2 \| PRO2242 \| TRIP-1 \| TRIP1 \| eIF3-beta \| eIF3-p36	eukaryotic translation initiation factor 3, subunit I	ER alpha interacts with TRIP1. This interaction was modeled on a demonstrated interaction between TRIP1 from an unspecified source and human ER alpha.	BIND	10706629
EP300	KAT3B \| p300	E1A binding protein p300	-	HPRD,BioGRID	11782371
EP300	KAT3B \| p300	E1A binding protein p300	EP300 (p300) acetylates ESR1 (ER-alpha). This interaction was modeled on a demonstrated interaction between EP300 from an unspecified species and ESR1 from an unspecified species.	BIND	14761960
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	Two-hybrid	BioGRID	12198596
ESR2	ER-BETA \| ESR-BETA \| ESRB \| ESTRB \| Erb \| NR3A2	estrogen receptor 2 (ER beta)	ER alpha interacts with ER beta to form heterodimer. This interaction was modeled on a demonstrated interaction between human ER alpha and mouse ER beta.	BIND	10706629
ESR2	ER-BETA \| ESR-BETA \| ESRB \| ESTRB \| Erb \| NR3A2	estrogen receptor 2 (ER beta)	-	HPRD,BioGRID	9473491
FHL2	AAG11 \| DRAL \| SLIM3	four and a half LIM domains 2	ER-alpha interacts with FHL2.	BIND	15666801
FKBP4	FKBP52 \| FKBP59 \| HBI \| Hsp56 \| PPIase \| p52	FK506 binding protein 4, 59kDa	Reconstituted Complex	BioGRID	9222609
FKBP5	FKBP51 \| FKBP54 \| MGC111006 \| P54 \| PPIase \| Ptg-10	FK506 binding protein 5	Reconstituted Complex	BioGRID	9222609
FOXO1	FKH1 \| FKHR \| FOXO1A	forkhead box O1	-	HPRD,BioGRID	11435445
FOXO4	AFX \| AFX1 \| MGC120490 \| MLLT7	forkhead box O4	-	HPRD,BioGRID	11435445
GADD45A	DDIT1 \| GADD45	growth arrest and DNA-damage-inducible, alpha	Affinity Capture-Western	BioGRID	10872826
GADD45B	DKFZp566B133 \| GADD45BETA \| MYD118	growth arrest and DNA-damage-inducible, beta	-	HPRD	10872826
GADD45G	CR6 \| DDIT2 \| GADD45gamma \| GRP17	growth arrest and DNA-damage-inducible, gamma	-	HPRD,BioGRID	10872826
GTF2H1	BTF2 \| TFB1 \| TFIIH	general transcription factor IIH, polypeptide 1, 62kDa	-	HPRD,BioGRID	10949034
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	ER-alpha interacts with HDAC1.	BIND	14506733
HSP90AA1	FLJ31884 \| HSP86 \| HSP89A \| HSP90A \| HSP90N \| HSPC1 \| HSPCA \| HSPCAL1 \| HSPCAL4 \| HSPN \| Hsp89 \| Hsp90 \| LAP2	heat shock protein 90kDa alpha (cytosolic), class A member 1	-	HPRD,BioGRID	11911945
HSPA4	APG-2 \| HS24/P52 \| MGC131852 \| RY \| hsp70 \| hsp70RY	heat shock 70kDa protein 4	Reconstituted Complex	BioGRID	9222609
IGF1R	CD221 \| IGFIR \| JTK13 \| MGC142170 \| MGC142172 \| MGC18216	insulin-like growth factor 1 receptor	Affinity Capture-Western	BioGRID	16113100
ISL1	Isl-1	ISL LIM homeobox 1	-	HPRD,BioGRID	11043578
JARID1A	KDM5A \| RBBP2 \| RBP2	jumonji, AT rich interactive domain 1A	Affinity Capture-Western Reconstituted Complex	BioGRID	11358960
JARID1A	KDM5A \| RBBP2 \| RBP2	jumonji, AT rich interactive domain 1A	Rbp2 interacts with ER.	BIND	11358960
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	ER-alpha interacts with c-Jun. This interaction was modeled on a demonstrated interaction between human ER-alpha, and mouse c-Jun.	BIND	11477071
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD,BioGRID	11477071
JUNB	AP-1	jun B proto-oncogene	ER-alpha interacts with JunB. This interaction was modeled on a demonstrated interaction between human ER-alpha and mouse JunB.	BIND	11477071
LOH3CR2A	ERR-10 \| ERR10 \| NAG-7 \| NAG7	loss of heterozygosity, 3, chromosomal region 2, gene A	-	HPRD	15474036
MAPK1	ERK \| ERK2 \| ERT1 \| MAPK2 \| P42MAPK \| PRKM1 \| PRKM2 \| p38 \| p40 \| p41 \| p41mapk	mitogen-activated protein kinase 1	-	HPRD,BioGRID	12093745
MDM2	HDMX \| MGC71221 \| hdm2	Mdm2 p53 binding protein homolog (mouse)	Reconstituted Complex	BioGRID	10766163
MED1	CRSP1 \| CRSP200 \| DRIP205 \| DRIP230 \| MGC71488 \| PBP \| PPARBP \| PPARGBP \| RB18A \| TRAP220 \| TRIP2	mediator complex subunit 1	ESR1 (ER-alpha) interacts with PPARBP (TRAP220). This interaction was modeled on a demonstrated interaction between ESR1 from an unspecified species and PPARBP from an unspecified species.	BIND	12738788
MED1	CRSP1 \| CRSP200 \| DRIP205 \| DRIP230 \| MGC71488 \| PBP \| PPARBP \| PPARGBP \| RB18A \| TRAP220 \| TRIP2	mediator complex subunit 1	Affinity Capture-Western	BioGRID	12837248
MED1	CRSP1 \| CRSP200 \| DRIP205 \| DRIP230 \| MGC71488 \| PBP \| PPARBP \| PPARGBP \| RB18A \| TRAP220 \| TRIP2	mediator complex subunit 1	-	HPRD	9653119
MED24	ARC100 \| CRSP100 \| CRSP4 \| DRIP100 \| KIAA0130 \| MGC8748 \| THRAP4 \| TRAP100	mediator complex subunit 24	-	HPRD	9653119
MED24	ARC100 \| CRSP100 \| CRSP4 \| DRIP100 \| KIAA0130 \| MGC8748 \| THRAP4 \| TRAP100	mediator complex subunit 24	Affinity Capture-MS	BioGRID	12837248
MGMT	-	O-6-methylguanine-DNA methyltransferase	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	11564893
MKNK2	GPRK7 \| MNK2	MAP kinase interacting serine/threonine kinase 2	-	HPRD,BioGRID	11013076
MMS19	FLJ34167 \| FLJ95146 \| MET18 \| MGC99604 \| MMS19L \| hMMS19	MMS19 nucleotide excision repair homolog (S. cerevisiae)	-	HPRD	11279242
MNAT1	MAT1 \| RNF66 \| TFB3	menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)	-	HPRD,BioGRID	12527756
MPG	AAG \| APNG \| CRA36.1 \| MDG \| Mid1 \| PIG11 \| PIG16 \| anpg	N-methylpurine-DNA glycosylase	ESR1 (ER-alpha) interacts with MPG.	BIND	14761960
MTA1	-	metastasis associated 1	-	HPRD,BioGRID	12167865
MVP	LRP \| VAULT1	major vault protein	-	HPRD,BioGRID	9628887
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	ER-alpha interacts with c-myc promoter.	BIND	15808510
NCAM2	MGC51008 \| NCAM21	neural cell adhesion molecule 2	ER interacts with NCAM2.	BIND	16009131
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	ER-alpha interacts with SRC-1	BIND	10938099
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	-	HPRD	9427757 \|11165056
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	Reconstituted Complex	BioGRID	9427757 \|11003650 \|11113179
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	ER alpha interacts with TIF2. This interaction was modeled on a demonstrated interaction between TIF2 from an unspecified source and human ER alpha.	BIND	10706629
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	-	HPRD,BioGRID	11937504
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	-	HPRD,BioGRID	11050174
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	SRC-3 interacts with ER. This interaction was modelled on a demonstrated interaction between human SRC-3 and ER from an unspecified species.	BIND	15383283
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	TRAM-1 interacts with ER.	BIND	9346901
NCOA4	ARA70 \| DKFZp762E1112 \| ELE1 \| PTC3 \| RFG	nuclear receptor coactivator 4	Reconstituted Complex	BioGRID	9892017
NCOA6	AIB3 \| ANTP \| ASC2 \| HOX1.1 \| HOXA7 \| KIAA0181 \| NRC \| PRIP \| RAP250 \| TRBP	nuclear receptor coactivator 6	Reconstituted Complex Two-hybrid	BioGRID	10567404 \|11158331 \|11773444
NCOA7	ERAP140 \| ESNA1 \| FLJ45605 \| MGC88425 \| Nbla00052 \| Nbla10993 \| dJ187J11.3	nuclear receptor coactivator 7	-	HPRD,BioGRID	11971969
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	-	HPRD,BioGRID	12145334
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	ESR1 (ER-alpha) interacts with NCOR1 (N-CoR). This interaction was modeled on a demonstrated interaction between ESR1 from an unspecified species and human NCOR1.	BIND	12738788
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	ESR1 (ER-alpha) interacts with NCOR2 (SMRT). This interaction was modeled on a demonstrated interaction between ESR1 from an unspecified species and NCOR2 from an unspecified species.	BIND	12738788
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	-	HPRD	9702189
NR0B2	FLJ17090 \| SHP \| SHP1	nuclear receptor subfamily 0, group B, member 2	-	HPRD,BioGRID	9773978 \|11861507
NR2C1	TR2	nuclear receptor subfamily 2, group C, member 1	-	HPRD,BioGRID	12093804
NR2C2	TAK1 \| TR2R1 \| TR4 \| hTAK1	nuclear receptor subfamily 2, group C, member 2	-	HPRD,BioGRID	11844790
NR2F1	COUP-TFI \| EAR-3 \| EAR3 \| ERBAL3 \| NR2F2 \| SVP44 \| TCFCOUP1 \| TFCOUP1	nuclear receptor subfamily 2, group F, member 1	-	HPRD,BioGRID	12093745
NR2F6	EAR-2 \| EAR2 \| ERBAL2	nuclear receptor subfamily 2, group F, member 6	-	HPRD,BioGRID	10713182
NRIP1	FLJ77253 \| RIP140	nuclear receptor interacting protein 1	ESR1 (ER-alpha) interacts with NRIP1 (RIP140). This interaction was modelled on a demonstrated interaction between human ESR1 and mouse NRIP1.	BIND	9774463
NRIP1	FLJ77253 \| RIP140	nuclear receptor interacting protein 1	ER interacts with NRIP-1 enhancer.	BIND	16009131
NRIP1	FLJ77253 \| RIP140	nuclear receptor interacting protein 1	-	HPRD,BioGRID	7641693
NSD1	ARA267 \| DKFZp666C163 \| FLJ10684 \| FLJ22263 \| FLJ44628 \| KMT3B \| SOTOS \| STO	nuclear receptor binding SET domain protein 1	-	HPRD	9628876
PAK6	PAK5	p21 protein (Cdc42/Rac)-activated kinase 6	-	HPRD,BioGRID	11773441
PELP1	HMX3 \| MNAR \| P160	proline, glutamate and leucine rich protein 1	-	HPRD,BioGRID	11481323
PGR	NR3C3 \| PR	progesterone receptor	ER-alpha interacts with the PgRA promoter.	BIND	15019994
PGR	NR3C3 \| PR	progesterone receptor	ER-alpha interacts with the PgRB promoter.	BIND	15019994
PHB2	BAP \| BCAP37 \| Bap37 \| MGC117268 \| PNAS-141 \| REA \| p22	prohibitin 2	ER-alpha interacts with REA	BIND	10938099
PHB2	BAP \| BCAP37 \| Bap37 \| MGC117268 \| PNAS-141 \| REA \| p22	prohibitin 2	Two-hybrid	BioGRID	12943695
PIAS1	DDXBP1 \| GBP \| GU/RH-II \| MGC141878 \| MGC141879 \| ZMIZ3	protein inhibitor of activated STAT, 1	ER-alpha interacts with PIAS1.	BIND	15666801
PIAS1	DDXBP1 \| GBP \| GU/RH-II \| MGC141878 \| MGC141879 \| ZMIZ3	protein inhibitor of activated STAT, 1	-	HPRD	15666801
PIAS2	MGC102682 \| MIZ1 \| PIASX \| PIASX-ALPHA \| PIASX-BETA \| SIZ2 \| ZMIZ4 \| miz	protein inhibitor of activated STAT, 2	Reconstituted Complex	BioGRID	11117529
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	-	HPRD,BioGRID	11689445
PNRC2	FLJ20312 \| MGC99541	proline-rich nuclear receptor coactivator 2	-	HPRD	11574675
POU2F1	OCT1 \| OTF1	POU class 2 homeobox 1	Reconstituted Complex	BioGRID	10480874
POU2F2	OCT2 \| OTF2 \| Oct-2	POU class 2 homeobox 2	Reconstituted Complex	BioGRID	10480874
POU4F1	BRN3A \| FLJ13449 \| Oct-T1 \| RDC-1	POU class 4 homeobox 1	Reconstituted Complex Two-hybrid	BioGRID	9448000
POU4F2	BRN3.2 \| BRN3B \| Brn-3b	POU class 4 homeobox 2	-	HPRD,BioGRID	9448000
PPARGC1A	LEM6 \| PGC-1(alpha) \| PGC-1v \| PGC1 \| PGC1A \| PPARGC1	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	-	HPRD,BioGRID	10748020
PPARGC1B	ERRL1 \| PERC \| PGC-1(beta) \| PGC1B	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	-	HPRD,BioGRID	11854298
PPID	CYP-40 \| CYPD \| MGC33096	peptidylprolyl isomerase D	Reconstituted Complex	BioGRID	9222609
PRDM2	HUMHOXY1 \| KMT8 \| MTB-ZF \| RIZ \| RIZ1 \| RIZ2	PR domain containing 2, with ZNF domain	-	HPRD,BioGRID	10706618
PRMT1	ANM1 \| HCP1 \| HRMT1L2 \| IR1B4	protein arginine methyltransferase 1	Reconstituted Complex	BioGRID	11050077
PRMT2	HRMT1L1 \| MGC111373	protein arginine methyltransferase 2	Affinity Capture-Western Reconstituted Complex	BioGRID	12039952
PRMT2	HRMT1L1 \| MGC111373	protein arginine methyltransferase 2	PRMT2 interacts with ER-alpha.	BIND	12039952
PRPF6	ANT-1 \| C20orf14 \| TOM \| U5-102K \| hPrp6	PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae)	-	HPRD	12039962
PTEN	10q23del \| BZS \| MGC11227 \| MHAM \| MMAC1 \| PTEN1 \| TEP1	phosphatase and tensin homolog	Reconstituted Complex	BioGRID	15205473
PTGES3	P23 \| TEBP \| cPGES	prostaglandin E synthase 3 (cytosolic)	Reconstituted Complex	BioGRID	9222609
PTGES3	P23 \| TEBP \| cPGES	prostaglandin E synthase 3 (cytosolic)	-	HPRD	10207098
PTMA	MGC104802 \| TMSA	prothymosin, alpha	Reconstituted Complex	BioGRID	12943695
RBM23	CAPERbeta \| FLJ10482 \| MGC4458 \| PP239 \| RNPC4	RNA binding motif protein 23	RBM23 (CAPER-beta) interacts with ESR1(ER-alpha)	BIND	15694343
RBM39	CAPER \| CAPERalpha \| CC1.3 \| DKFZp781C0423 \| FLJ44170 \| HCC1 \| RNPC2 \| fSAP59	RNA binding motif protein 39	-	HPRD,BioGRID	11704680
RBM9	FOX2 \| Fox-2 \| HNRBP2 \| HRNBP2 \| RTA \| dJ106I20.3 \| fxh	RNA binding motif protein 9	-	HPRD,BioGRID	11875103
REXO4	REX4 \| XPMC2 \| XPMC2H	REX4, RNA exonuclease 4 homolog (S. cerevisiae)	-	HPRD,BioGRID	10908561
RFX4	NYD-SP10	regulatory factor X, 4 (influences HLA class II expression)	-	HPRD	1603086 \|10706293
RNF14	ARA54 \| FLJ26004 \| HFB30 \| HRIHFB2038 \| TRIAD2	ring finger protein 14	-	HPRD	10085091
RNF4	RES4-26 \| SNURF	ring finger protein 4	Two-hybrid	BioGRID	9710597
SAFB	DKFZp779C1727 \| HAP \| HET \| SAFB1	scaffold attachment factor B	-	HPRD,BioGRID	10707955
SAFB2	KIAA0138	scaffold attachment factor B2	Affinity Capture-Western Reconstituted Complex	BioGRID	12660241
SFI1	MGC131712 \| MGC150663 \| MGC156283 \| MGC57874 \| PISD \| RP5-858B16.1 \| hSfi1p	Sfi1 homolog, spindle assembly associated (yeast)	ER interacts with SFI1.	BIND	16009131
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD,BioGRID	11773443
SLC37A1	FLJ22340 \| G3PP	solute carrier family 37 (glycerol-3-phosphate transporter), member 1	ER interacts with SLC37A1.	BIND	16009131
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	-	HPRD,BioGRID	11555647
SMARCA2	BAF190 \| BRM \| FLJ36757 \| MGC74511 \| SNF2 \| SNF2L2 \| SNF2LA \| SWI2 \| Sth1p \| hBRM \| hSNF2a	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	-	HPRD,BioGRID	9099865
SMARCA4	BAF190 \| BRG1 \| FLJ39786 \| SNF2 \| SNF2-BETA \| SNF2L4 \| SNF2LB \| SWI2 \| hSNF2b	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	-	HPRD,BioGRID	9099865
SMARCD1	BAF60A \| CRACD1 \| Rsc6p	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1	Reconstituted Complex	BioGRID	12917342
SMARCE1	BAF57	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1	-	HPRD,BioGRID	12145209
SNAP29	CEDNIK \| FLJ21051 \| SNAP-29	synaptosomal-associated protein, 29kDa	ER interacts with SNAP29.	BIND	16009131
SNURF	-	SNRPN upstream reading frame	Two-hybrid	BioGRID	11696545
SOD1	ALS \| ALS1 \| IPOA \| SOD \| homodimer	superoxide dismutase 1, soluble	ER interacts with SOD-1 enhancer.	BIND	16009131
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	Affinity Capture-Western Reconstituted Complex	BioGRID	10454579 \|11032808 \|11564893
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	Affinity Capture-Western	BioGRID	11429412
STAT5A	MGF \| STAT5	signal transducer and activator of transcription 5A	ER-alpha interacts with STAT5a.	BIND	15304355
STAT5A	MGF \| STAT5	signal transducer and activator of transcription 5A	Reconstituted Complex	BioGRID	11682624
STRN	MGC125642 \| SG2NA	striatin, calmodulin binding protein	-	HPRD	15569929
SVIL	DKFZp686A17191	supervillin	Two-hybrid	BioGRID	11792840
TADA3L	ADA3 \| FLJ20221 \| FLJ21329 \| hADA3	transcriptional adaptor 3 (NGG1 homolog, yeast)-like	-	HPRD,BioGRID	12034840
TAF10	TAF2A \| TAF2H \| TAFII30	TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa	-	HPRD	7923369
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	-	HPRD,BioGRID	11595744
TDG	-	thymine-DNA glycosylase	-	HPRD,BioGRID	12874288
TFF1	BCEI \| D21S21 \| HP1.A \| HPS2 \| pNR-2 \| pS2	trefoil factor 1	ER-alpha interacts with pS2.	BIND	10490106
TFF1	BCEI \| D21S21 \| HP1.A \| HPS2 \| pNR-2 \| pS2	trefoil factor 1	ER interacts with TFF-1 promoter.	BIND	16009131
TFF1	BCEI \| D21S21 \| HP1.A \| HPS2 \| pNR-2 \| pS2	trefoil factor 1	ER interacts with TFF-1 enhancer.	BIND	16009131
TFF1	BCEI \| D21S21 \| HP1.A \| HPS2 \| pNR-2 \| pS2	trefoil factor 1	ER-alpha interacts with the pS2 promoter.	BIND	15304487
THOC5	C22orf19 \| Fmip \| PK1.3 \| fSAP79	THO complex 5	ER interacts with C22orf19.	BIND	16009131
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	10766163
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	P53 interacts with ER-alpha.	BIND	10766163
TRIM24	PTC6 \| RNF82 \| TF1A \| TIF1 \| TIF1A \| TIF1ALPHA \| hTIF1	tripartite motif-containing 24	Reconstituted Complex	BioGRID	9115274 \|10598587
TRIM24	PTC6 \| RNF82 \| TF1A \| TIF1 \| TIF1A \| TIF1ALPHA \| hTIF1	tripartite motif-containing 24	-	HPRD	9115274 \|9632676 \|10598587
TRIM24	PTC6 \| RNF82 \| TF1A \| TIF1 \| TIF1A \| TIF1ALPHA \| hTIF1	tripartite motif-containing 24	ESR1 (ER-alpha) interacts with TIF1. This interaction was modeled on a demonstrated interaction between human ESR1 and mouse TIF1.	BIND	9774463
TRIP4	HsT17391	thyroid hormone receptor interactor 4	-	HPRD,BioGRID	10454579
TRRAP	FLJ10671 \| PAF350/400 \| PAF400 \| STAF40 \| TR-AP \| Tra1	transformation/transcription domain-associated protein	ESR1 (ER-alpha) interacts with TRRAP. This interaction was modeled on a demonstrated interaction between ESR1 from an unspecified species and TRRAP from an unspecified species.	BIND	12738788
TRRAP	FLJ10671 \| PAF350/400 \| PAF400 \| STAF40 \| TR-AP \| Tra1	transformation/transcription domain-associated protein	Affinity Capture-MS	BioGRID	12837248
UBE2I	C358B7.1 \| P18 \| UBC9	ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	ER-alpha interacts with an unspecified isoform of Ubc9.	BIND	15666801
XBP1	TREB5 \| XBP2	X-box binding protein 1	-	HPRD,BioGRID	12954762
XBP1	TREB5 \| XBP2	X-box binding protein 1	ER interacts with XBP-1 enhancer.	BIND	16009131
YWHAH	YWHA1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide	-	HPRD	11266503
YWHAQ	14-3-3 \| 1C5 \| HS1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide	Reconstituted Complex	BioGRID	11266503
ZBTB16	PLZF \| ZNF145	zinc finger and BTB domain containing 16	-	HPRD,BioGRID	14521715
ZNF398	KIAA1339 \| P51 \| P71 \| ZER6	zinc finger protein 398	-	HPRD,BioGRID	11779858

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA CARM ER PATHWAY	35	27	All SZGR 2.0 genes in this pathway
BIOCARTA MTA3 PATHWAY	19	10	All SZGR 2.0 genes in this pathway
BIOCARTA HER2 PATHWAY	22	17	All SZGR 2.0 genes in this pathway
PID SMAD2 3NUCLEAR PATHWAY	82	63	All SZGR 2.0 genes in this pathway
PID HDAC CLASSII PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID ER NONGENOMIC PATHWAY	41	35	All SZGR 2.0 genes in this pathway
PID LKB1 PATHWAY	47	37	All SZGR 2.0 genes in this pathway
PID TELOMERASE PATHWAY	68	48	All SZGR 2.0 genes in this pathway
PID ATF2 PATHWAY	59	43	All SZGR 2.0 genes in this pathway
PID AP1 PATHWAY	70	60	All SZGR 2.0 genes in this pathway
PID FOXM1 PATHWAY	40	30	All SZGR 2.0 genes in this pathway
PID ERA GENOMIC PATHWAY	65	37	All SZGR 2.0 genes in this pathway
PID P38 ALPHA BETA DOWNSTREAM PATHWAY	38	29	All SZGR 2.0 genes in this pathway
PID HNF3A PATHWAY	44	29	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB4	90	67	All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR SIGNALING BY ERBB4	38	30	All SZGR 2.0 genes in this pathway
REACTOME GENERIC TRANSCRIPTION PATHWAY	352	181	All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR RECEPTOR TRANSCRIPTION PATHWAY	49	36	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE DN	384	220	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP	380	215	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP	450	256	All SZGR 2.0 genes in this pathway
DOANE BREAST CANCER ESR1 UP	112	72	All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN	384	230	All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP	269	146	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED UP	78	48	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP	119	66	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA DN	146	94	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA BY DMOG DN	59	40	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A DN	90	61	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 12HR	43	35	All SZGR 2.0 genes in this pathway
SCHEIDEREIT IKK TARGETS	18	15	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS LUMINAL	326	213	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
JAERVINEN AMPLIFIED IN LARYNGEAL CANCER	40	24	All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL DN	114	58	All SZGR 2.0 genes in this pathway
DAWSON METHYLATED IN LYMPHOMA TCL1	59	45	All SZGR 2.0 genes in this pathway
YANG BREAST CANCER ESR1 UP	36	22	All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP	390	236	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK	101	73	All SZGR 2.0 genes in this pathway
OHM METHYLATED IN ADULT CANCERS	27	23	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
SAKAI CHRONIC HEPATITIS VS LIVER CANCER DN	36	24	All SZGR 2.0 genes in this pathway
PENG GLUCOSE DEPRIVATION UP	48	26	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 6HR	59	38	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL	254	164	All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS	108	71	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP	428	266	All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 3HR	74	47	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
LOPES METHYLATED IN COLON CANCER UP	27	20	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN	220	147	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN	258	160	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN	540	340	All SZGR 2.0 genes in this pathway
HOQUE METHYLATED IN CANCER	56	45	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BRAIN DN	85	58	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE UP	97	61	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B UP	172	109	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL A UP	84	52	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C	463	262	All SZGR 2.0 genes in this pathway
BUCKANOVICH T LYMPHOCYTE HOMING ON TUMOR UP	24	11	All SZGR 2.0 genes in this pathway
MATZUK PREOVULATORY FOLLICLE	10	8	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP	425	298	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 UP	167	99	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A4	196	124	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE DN	181	97	All SZGR 2.0 genes in this pathway
POOLA INVASIVE BREAST CANCER DN	134	83	All SZGR 2.0 genes in this pathway
YAMASHITA LIVER CANCER STEM CELL UP	47	38	All SZGR 2.0 genes in this pathway
YAMASHITA LIVER CANCER STEM CELL DN	76	51	All SZGR 2.0 genes in this pathway
LI PROSTATE CANCER EPIGENETIC	30	22	All SZGR 2.0 genes in this pathway
PYEON CANCER HEAD AND NECK VS CERVICAL UP	193	95	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 2	86	50	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 3	15	7	All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR DN	88	59	All SZGR 2.0 genes in this pathway
ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS DN	116	74	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 DN	88	61	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 DN	82	51	All SZGR 2.0 genes in this pathway
SERVITJA LIVER HNF1A TARGETS DN	157	105	All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7	403	240	All SZGR 2.0 genes in this pathway
WANG MLL TARGETS	289	188	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL DN	428	246	All SZGR 2.0 genes in this pathway
LIM MAMMARY LUMINAL MATURE UP	116	65	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER CLUSTER 6	16	13	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-130/301	3766	3772	m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-148/152	3767	3773	m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-18	1938	1945	1A,m8	hsa-miR-18a	UAAGGUGCAUCUAGUGCAGAUA
miR-18	1938	1945	1A,m8	hsa-miR-18b	UAAGGUGCAUCUAGUGCAGUUA
miR-181	1998	2005	1A,m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-188	196	202	m8	hsa-miR-188	CAUCCCUUGCAUGGUGGAGGGU
miR-19	4216	4222	m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
				hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
				hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
				hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-203.1	2165	2172	1A,m8	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-204/211	195	201	m8	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	195	201	m8	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-219	2244	2250	m8	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-22	2292	2299	1A,m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-221/222	2253	2260	1A,m8	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	2253	2260	1A,m8	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-26	3982	3988	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	3982	3988	1A	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-330	4182	4188	m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-361	3233	3239	1A	hsa-miR-361^brain	UUAUCAGAAUCUCCAGGGGUAC
miR-496	3841	3847	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-9	3086	3092	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-93.hd/291-3p/294/295/302/372/373/520	379	385	m8	hsa-miR-93^brain	AAAGUGCUGUUCGUGCAGGUAG
				hsa-miR-302a	UAAGUGCUUCCAUGUUUUGGUGA
				hsa-miR-302b	UAAGUGCUUCCAUGUUUUAGUAG
				hsa-miR-302c	UAAGUGCUUCCAUGUUUCAGUGG
				hsa-miR-302d	UAAGUGCUUCCAUGUUUGAGUGU
				hsa-miR-372	AAAGUGCUGCGACAUUUGAGCGU
				hsa-miR-373	GAAGUGCUUCGAUUUUGGGGUGU
				hsa-miR-520e	AAAGUGCUUCCUUUUUGAGGG
				hsa-miR-520a	AAAGUGCUUCCCUUUGGACUGU
				hsa-miR-520b	AAAGUGCUUCCUUUUAGAGGG
				hsa-miR-520c	AAAGUGCUUCCUUUUAGAGGGUU
				hsa-miR-520d	AAAGUGCUUCUCUUUGGUGGGUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ESR1