Gene Page: F13A1
Summary ?
GeneID | 2162 |
Symbol | F13A1 |
Synonyms | F13A |
Description | coagulation factor XIII A chain |
Reference | MIM:134570|HGNC:HGNC:3531|Ensembl:ENSG00000124491|HPRD:00604|Vega:OTTHUMG00000014186 |
Gene type | protein-coding |
Map location | 6p25.3-p24.3 |
Pascal p-value | 0.075 |
Fetal beta | -1.171 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0159 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg27097018 | 6 | 6320614 | F13A1 | 3.45E-8 | -0.036 | 1.02E-5 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs17046387 | chr2 | 55052948 | F13A1 | 2162 | 0.09 | trans | ||
rs726253 | chr2 | 150754825 | F13A1 | 2162 | 0.07 | trans | ||
rs1020088 | chr2 | 150828832 | F13A1 | 2162 | 0.06 | trans | ||
rs4514358 | chr10 | 43861923 | F13A1 | 2162 | 0.08 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
KNTC1 | 0.95 | 0.84 |
TIMELESS | 0.95 | 0.80 |
NCAPH | 0.95 | 0.81 |
CDK2 | 0.95 | 0.58 |
SPAG5 | 0.95 | 0.77 |
EME1 | 0.95 | 0.71 |
CDC45L | 0.95 | 0.72 |
IQGAP3 | 0.94 | 0.80 |
RAD51 | 0.94 | 0.74 |
TACC3 | 0.94 | 0.72 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.27 | -0.46 | -0.81 |
AF347015.31 | -0.45 | -0.80 |
AIFM3 | -0.45 | -0.70 |
HLA-F | -0.45 | -0.66 |
PTH1R | -0.45 | -0.66 |
AF347015.33 | -0.45 | -0.79 |
MT-CO2 | -0.45 | -0.81 |
C5orf53 | -0.44 | -0.62 |
MT-CYB | -0.44 | -0.79 |
FBXO2 | -0.44 | -0.57 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003810 | protein-glutamine gamma-glutamyltransferase activity | IEA | - | |
GO:0003810 | protein-glutamine gamma-glutamyltransferase activity | TAS | 2877456 | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
GO:0008415 | acyltransferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007596 | blood coagulation | IEA | - | |
GO:0007596 | blood coagulation | TAS | 10801785 | |
GO:0018149 | peptide cross-linking | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | EXP | 2866798 | |
GO:0005576 | extracellular region | TAS | 2877457 | |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG COMPLEMENT AND COAGULATION CASCADES | 69 | 49 | All SZGR 2.0 genes in this pathway |
BIOCARTA FIBRINOLYSIS PATHWAY | 12 | 8 | All SZGR 2.0 genes in this pathway |
PID INTEGRIN1 PATHWAY | 66 | 44 | All SZGR 2.0 genes in this pathway |
PID INTEGRIN A9B1 PATHWAY | 25 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME RESPONSE TO ELEVATED PLATELET CYTOSOLIC CA2 | 89 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME COMMON PATHWAY | 14 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME FORMATION OF FIBRIN CLOT CLOTTING CASCADE | 32 | 22 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION | 208 | 138 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 DN | 267 | 178 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN | 116 | 79 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D DN | 142 | 90 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL DN | 226 | 132 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS DN | 161 | 93 | All SZGR 2.0 genes in this pathway |
KONG E2F3 TARGETS | 97 | 58 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
GNATENKO PLATELET SIGNATURE | 48 | 28 | All SZGR 2.0 genes in this pathway |
ALCALAY AML BY NPM1 LOCALIZATION UP | 140 | 83 | All SZGR 2.0 genes in this pathway |
STOSSI RESPONSE TO ESTRADIOL | 50 | 35 | All SZGR 2.0 genes in this pathway |
LENAOUR DENDRITIC CELL MATURATION UP | 114 | 84 | All SZGR 2.0 genes in this pathway |
HADDAD T LYMPHOCYTE AND NK PROGENITOR DN | 63 | 41 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
EHRLICH ICF SYNDROM UP | 13 | 8 | All SZGR 2.0 genes in this pathway |
MCLACHLAN DENTAL CARIES DN | 245 | 144 | All SZGR 2.0 genes in this pathway |
KAAB FAILED HEART VENTRICLE DN | 41 | 28 | All SZGR 2.0 genes in this pathway |
MCLACHLAN DENTAL CARIES UP | 253 | 147 | All SZGR 2.0 genes in this pathway |
LEIN CHOROID PLEXUS MARKERS | 103 | 61 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P3 | 160 | 103 | All SZGR 2.0 genes in this pathway |
GAVIN PDE3B TARGETS | 22 | 15 | All SZGR 2.0 genes in this pathway |
ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL A UP | 84 | 52 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D DN | 252 | 155 | All SZGR 2.0 genes in this pathway |
BOHN PRIMARY IMMUNODEFICIENCY SYNDROM DN | 40 | 31 | All SZGR 2.0 genes in this pathway |
LINDSTEDT DENDRITIC CELL MATURATION D | 68 | 44 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
VANASSE BCL2 TARGETS DN | 74 | 50 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
JISON SICKLE CELL DISEASE UP | 181 | 106 | All SZGR 2.0 genes in this pathway |
YOSHIOKA LIVER CANCER EARLY RECURRENCE UP | 40 | 23 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA1 UP | 76 | 46 | All SZGR 2.0 genes in this pathway |
RAGHAVACHARI PLATELET SPECIFIC GENES | 70 | 46 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS UP | 387 | 225 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
BOSCO TH1 CYTOTOXIC MODULE | 114 | 62 | All SZGR 2.0 genes in this pathway |
ALTEMEIER RESPONSE TO LPS WITH MECHANICAL VENTILATION | 128 | 81 | All SZGR 2.0 genes in this pathway |
NABA ECM REGULATORS | 238 | 125 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 723 | 729 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-182 | 565 | 571 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-335 | 77 | 83 | m8 | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
miR-383 | 732 | 738 | 1A | hsa-miR-383brain | AGAUCAGAAGGUGAUUGUGGCU |
miR-542-3p | 718 | 724 | 1A | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
miR-96 | 565 | 571 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.