Gene Page: ALDH9A1
Summary ?
| GeneID | 223 |
| Symbol | ALDH9A1 |
| Synonyms | ALDH4|ALDH7|ALDH9|E3|TMABADH |
| Description | aldehyde dehydrogenase 9 family member A1 |
| Reference | MIM:602733|HGNC:HGNC:412|Ensembl:ENSG00000143149|HPRD:04109|Vega:OTTHUMG00000034677 |
| Gene type | protein-coding |
| Map location | 1q23.1 |
| Sherlock p-value | 0.029 |
| Fetal beta | -0.218 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg08343943 | 1 | 165668116 | ALDH9A1 | -0.028 | 0.91 | DMG:Nishioka_2013 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs17276327 | chr4 | 12326149 | ALDH9A1 | 223 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TUBA1 | 0.93 | 0.85 |
| RHBDD2 | 0.92 | 0.91 |
| TUBG2 | 0.91 | 0.86 |
| CTSD | 0.91 | 0.93 |
| COPS7A | 0.91 | 0.90 |
| THY1 | 0.91 | 0.88 |
| GOT1 | 0.90 | 0.87 |
| BSCL2 | 0.89 | 0.88 |
| ABHD12 | 0.89 | 0.89 |
| SNRPN | 0.89 | 0.91 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RBMX2 | -0.59 | -0.66 |
| KIAA1949 | -0.59 | -0.48 |
| ZNF311 | -0.57 | -0.46 |
| ZNF300 | -0.57 | -0.39 |
| TUBB2B | -0.56 | -0.52 |
| THOC2 | -0.56 | -0.57 |
| SH3BP2 | -0.56 | -0.58 |
| FNBP1L | -0.56 | -0.37 |
| UPF3A | -0.55 | -0.58 |
| ZNF551 | -0.55 | -0.41 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004029 | aldehyde dehydrogenase (NAD) activity | IDA | 2925663 | |
| GO:0016491 | oxidoreductase activity | IEA | - | |
| GO:0019145 | aminobutyraldehyde dehydrogenase activity | IDA | 2925663 |8645224 | |
| GO:0047105 | 4-trimethylammoniobutyraldehyde dehydrogenase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0042136 | neurotransmitter biosynthetic process | IDA | neuron, axon, Synap, Neurotransmitter (GO term level: 9) | 2925663 |
| GO:0006081 | cellular aldehyde metabolic process | IDA | 8645224 | |
| GO:0009437 | carnitine metabolic process | IEA | - | |
| GO:0042445 | hormone metabolic process | TAS | 2925663 | |
| GO:0055114 | oxidation reduction | IDA | 2925663 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005829 | cytosol | IEA | - | |
| GO:0005856 | cytoskeleton | IDA | 18029348 | |
| GO:0005634 | nucleus | IDA | 18029348 | |
| GO:0005737 | cytoplasm | TAS | 2925663 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG GLYCOLYSIS GLUCONEOGENESIS | 62 | 41 | All SZGR 2.0 genes in this pathway |
| KEGG ASCORBATE AND ALDARATE METABOLISM | 25 | 17 | All SZGR 2.0 genes in this pathway |
| KEGG FATTY ACID METABOLISM | 42 | 29 | All SZGR 2.0 genes in this pathway |
| KEGG VALINE LEUCINE AND ISOLEUCINE DEGRADATION | 44 | 26 | All SZGR 2.0 genes in this pathway |
| KEGG LYSINE DEGRADATION | 44 | 29 | All SZGR 2.0 genes in this pathway |
| KEGG ARGININE AND PROLINE METABOLISM | 54 | 39 | All SZGR 2.0 genes in this pathway |
| KEGG HISTIDINE METABOLISM | 29 | 19 | All SZGR 2.0 genes in this pathway |
| KEGG TRYPTOPHAN METABOLISM | 40 | 33 | All SZGR 2.0 genes in this pathway |
| KEGG BETA ALANINE METABOLISM | 22 | 16 | All SZGR 2.0 genes in this pathway |
| KEGG GLYCEROLIPID METABOLISM | 49 | 26 | All SZGR 2.0 genes in this pathway |
| KEGG PYRUVATE METABOLISM | 40 | 26 | All SZGR 2.0 genes in this pathway |
| KEGG PROPANOATE METABOLISM | 33 | 22 | All SZGR 2.0 genes in this pathway |
| KEGG BUTANOATE METABOLISM | 34 | 20 | All SZGR 2.0 genes in this pathway |
| KEGG LIMONENE AND PINENE DEGRADATION | 10 | 8 | All SZGR 2.0 genes in this pathway |
| PID MYC REPRESS PATHWAY | 63 | 52 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF AMINO ACIDS AND DERIVATIVES | 200 | 136 | All SZGR 2.0 genes in this pathway |
| ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 3 UP | 329 | 196 | All SZGR 2.0 genes in this pathway |
| WANG BARRETTS ESOPHAGUS DN | 25 | 13 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM4 | 261 | 153 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR UP | 176 | 115 | All SZGR 2.0 genes in this pathway |
| GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL CIS | 128 | 77 | All SZGR 2.0 genes in this pathway |
| CHESLER BRAIN QTL CIS | 75 | 51 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL CIS | 65 | 38 | All SZGR 2.0 genes in this pathway |
| KUROKAWA LIVER CANCER CHEMOTHERAPY DN | 41 | 28 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| SESTO RESPONSE TO UV C8 | 72 | 56 | All SZGR 2.0 genes in this pathway |
| KAYO AGING MUSCLE DN | 123 | 76 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
| KYNG DNA DAMAGE BY GAMMA AND UV RADIATION | 88 | 65 | All SZGR 2.0 genes in this pathway |
| KYNG DNA DAMAGE DN | 195 | 135 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
| CROMER TUMORIGENESIS DN | 51 | 29 | All SZGR 2.0 genes in this pathway |
| HOSHIDA LIVER CANCER SURVIVAL DN | 113 | 76 | All SZGR 2.0 genes in this pathway |
| DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
| DANG MYC TARGETS DN | 31 | 25 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 17 | 181 | 101 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 36HR | 29 | 23 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124/506 | 181 | 187 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.