Gene Page: ANKS1A
Summary ?
GeneID | 23294 |
Symbol | ANKS1A |
Synonyms | ANKS1 |
Description | ankyrin repeat and sterile alpha motif domain containing 1A |
Reference | MIM:608994|HGNC:HGNC:20961|Ensembl:ENSG00000064999|HPRD:10610|Vega:OTTHUMG00000014559 |
Gene type | protein-coding |
Map location | 6p21.31 |
Pascal p-value | 0.028 |
Sherlock p-value | 0.053 |
eGene | Cortex Meta |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0156 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
ANKS1A | chr6 | 34952962 | G | T | NM_015245 | . | silent | Schizophrenia | DNM:Fromer_2014 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg13028789 | 6 | 34856920 | ANKS1A;TAF11 | 5.64E-5 | -0.372 | 0.022 | DMG:Wockner_2014 |
cg00215801 | 6 | 34855797 | TAF11;ANKS1A | 6.94E-5 | -0.332 | 0.024 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 17353931 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP | 177 | 110 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
MAGRANGEAS MULTIPLE MYELOMA IGLL VS IGLK DN | 24 | 18 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP | 131 | 87 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS DN | 314 | 188 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
LEE METASTASIS AND ALTERNATIVE SPLICING UP | 74 | 51 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A5 | 70 | 32 | All SZGR 2.0 genes in this pathway |
NIELSEN GIST | 98 | 66 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
LINSLEY MIR16 TARGETS | 206 | 127 | All SZGR 2.0 genes in this pathway |
BILANGES SERUM SENSITIVE GENES | 90 | 54 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 2584 | 2590 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-142-3p | 1824 | 1830 | m8 | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
miR-144 | 2584 | 2590 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-26 | 2558 | 2565 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-365 | 864 | 871 | 1A,m8 | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.