Gene Page: OTP
Summary ?
GeneID | 23440 |
Symbol | OTP |
Synonyms | - |
Description | orthopedia homeobox |
Reference | MIM:604529|HGNC:HGNC:8518|HPRD:05166| |
Gene type | protein-coding |
Map location | 5q13.3 |
Pascal p-value | 0.236 |
DMG | 2 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg02164129 | 5 | 76926550 | OTP | 5.69E-5 | -0.396 | 0.022 | DMG:Wockner_2014 |
cg25547361 | 5 | 76926079 | OTP | 7.17E-10 | -0.016 | 9.89E-7 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10994209 | chr10 | 61877705 | OTP | 23440 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | IEA | neurite (GO term level: 5) | - |
GO:0002052 | positive regulation of neuroblast proliferation | IEA | - | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0021985 | neurohypophysis development | IEA | - | |
GO:0021979 | hypothalamus cell differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB MORPHOLINO DN | 200 | 112 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB TARGETS | 74 | 41 | All SZGR 2.0 genes in this pathway |
SHEPARD CRUSH AND BURN MUTANT DN | 185 | 111 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
HANN RESISTANCE TO BCL2 INHIBITOR DN | 48 | 31 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K27ME3 | 79 | 59 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-194 | 1377 | 1383 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
miR-208 | 677 | 683 | 1A | hsa-miR-208 | AUAAGACGAGCAAAAAGCUUGU |
miR-218 | 656 | 662 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-219 | 1265 | 1271 | 1A | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
miR-23 | 1340 | 1346 | 1A | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-326 | 1303 | 1310 | 1A,m8 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
miR-375 | 1332 | 1338 | 1A | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
miR-499 | 677 | 683 | 1A | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
miR-503 | 1142 | 1148 | m8 | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
miR-544 | 554 | 560 | 1A | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.