SZGR2

Summary ?

GeneID	23774
Symbol	BRD1
Synonyms	BRL\|BRPF1\|BRPF2
Description	bromodomain containing 1
Reference	MIM:604589\|HGNC:HGNC:1102\|Ensembl:ENSG00000100425\|HPRD:06848\|Vega:OTTHUMG00000150288
Gene type	protein-coding
Map location	22q13.33
Pascal p-value	6.558E-6
Fetal beta	1.195
eGene	Cerebellum Myers' cis & trans
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	1	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs16829545	chr2	151977407	BRD1	23774	0.04	trans
rs6741060	chr2	217169088	BRD1	23774	0.1	trans
rs16955618	chr15	29937543	BRD1	23774	0.05	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003674	molecular_function	ND		-
GO:0005515	protein binding	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008150	biological_process	ND		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	TAS		10602503

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
LAIHO COLORECTAL CANCER SERRATED DN	86	47	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN	335	193	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
MANTOVANI NFKB TARGETS DN	11	6	All SZGR 2.0 genes in this pathway
MANTOVANI VIRAL GPCR SIGNALING DN	49	37	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP	195	138	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 22Q13 AMPLICON	17	15	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP	390	242	All SZGR 2.0 genes in this pathway
SU TESTIS	76	53	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC DN	123	86	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR DN	160	101	All SZGR 2.0 genes in this pathway
CHENG IMPRINTED BY ESTRADIOL	110	68	All SZGR 2.0 genes in this pathway
NICK RESPONSE TO PROC TREATMENT DN	27	18	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN	442	275	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE DN	181	97	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-137	792	798	1A	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-142-5p	589	595	1A	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-155	876	882	m8	hsa-miR-155	UUAAUGCUAAUCGUGAUAGGGG
miR-181	284	290	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-21	39	45	m8	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	39	45	m8	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-30-5p	740	747	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-448	625	631	m8	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-455	642	649	1A,m8	hsa-miR-455	UAUGUGCCUUUGGACUACAUCG
miR-543	285	291	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: BRD1