Gene Page: GNAL
Summary ?
GeneID | 2774 |
Symbol | GNAL |
Synonyms | DYT25 |
Description | G protein subunit alpha L |
Reference | MIM:139312|HGNC:HGNC:4388|Ensembl:ENSG00000141404|HPRD:00758|Vega:OTTHUMG00000131660 |
Gene type | protein-coding |
Map location | 18p11.22-p11.21 |
Pascal p-value | 0.01 |
Fetal beta | 0.794 |
eGene | Myers' cis & trans |
Support | G-PROTEIN RELAY CompositeSet Darnell FMRP targets Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenics,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs7370564 | 0 | GNAL | 2774 | 0.12 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C1orf54 | 0.82 | 0.79 |
AL138743.2 | 0.82 | 0.77 |
AL050337.1 | 0.81 | 0.71 |
VAMP5 | 0.81 | 0.77 |
SYCP3 | 0.74 | 0.66 |
C1orf61 | 0.72 | 0.60 |
S100A13 | 0.71 | 0.71 |
AF347015.21 | 0.71 | 0.69 |
RP11-884K10.1 | 0.70 | 0.78 |
NMI | 0.70 | 0.76 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ATXN2 | -0.73 | -0.74 |
GBF1 | -0.72 | -0.77 |
DNAJC11 | -0.71 | -0.65 |
CABIN1 | -0.71 | -0.74 |
BRSK2 | -0.71 | -0.75 |
MYO18A | -0.71 | -0.73 |
AP3D1 | -0.71 | -0.73 |
HERC2 | -0.71 | -0.77 |
USP35 | -0.70 | -0.72 |
MED15 | -0.70 | -0.72 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004871 | signal transducer activity | IEA | - | |
GO:0003924 | GTPase activity | TAS | 8243272 | |
GO:0005525 | GTP binding | IEA | - | |
GO:0019001 | guanyl nucleotide binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007191 | dopamine receptor, adenylate cyclase activating pathway | IEA | dopamine (GO term level: 12) | - |
GO:0007190 | activation of adenylate cyclase activity | IEA | - | |
GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
GO:0007165 | signal transduction | IEA | - | |
GO:0007165 | signal transduction | TAS | 8243272 | |
GO:0007608 | sensory perception of smell | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
KEGG OLFACTORY TRANSDUCTION | 389 | 85 | All SZGR 2.0 genes in this pathway |
PID ENDOTHELIN PATHWAY | 63 | 52 | All SZGR 2.0 genes in this pathway |
PID ER NONGENOMIC PATHWAY | 41 | 35 | All SZGR 2.0 genes in this pathway |
PID LPA4 PATHWAY | 15 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME OPIOID SIGNALLING | 78 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME ADENYLATE CYCLASE ACTIVATING PATHWAY | 10 | 8 | All SZGR 2.0 genes in this pathway |
REACTOME ADENYLATE CYCLASE INHIBITORY PATHWAY | 13 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME NEUROTRANSMITTER RECEPTOR BINDING AND DOWNSTREAM TRANSMISSION IN THE POSTSYNAPTIC CELL | 137 | 110 | All SZGR 2.0 genes in this pathway |
REACTOME OLFACTORY SIGNALING PATHWAY | 328 | 60 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME GABA B RECEPTOR ACTIVATION | 38 | 26 | All SZGR 2.0 genes in this pathway |
REACTOME GABA RECEPTOR ACTIVATION | 52 | 40 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
SCHLESINGER H3K27ME3 IN NORMAL AND METHYLATED IN CANCER | 28 | 21 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
BROWN MYELOID CELL DEVELOPMENT DN | 129 | 86 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
KYNG NORMAL AGING UP | 19 | 11 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM UP | 20 | 10 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 138 | 144 | m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-124/506 | 780 | 786 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-544 | 580 | 586 | 1A | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.